LXL04_011999 | RubberDandelionOmics

Gene overview

LXL04_011999

Reference: OH-1004 Chr: Chr03 Coordinates: 4447410-4453834 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3654 bp · LXL04_011999|LXL04_011999|OH1004|cDNA

ATGCCTTCACTTGCCGTTCTACCTGAAACCCTATCCCCATCATCTGAAGTCCTCAAGACGAAGACCAAGAAGATGAAGAACGACACCTCCGAAACCGTCGGACTCGAATCTTCAATcaagaaagagaaaaagagcAAAAAGAATAAGACCGACACTCCTTCCGATACTGAAAAATCCGAGAAAAAAAGCAAGAAGAAACGTAAGGCTTCTTCGGATACAGATAACGAAGAAGGAAAGAGCGATACAAGCGAACTAGTCGA...

CDS

Download CDS FASTA

3654 bp · LXL04_011999|LXL04_011999|OH1004|CDS

ATGCCTTCACTTGCCGTTCTACCTGAAACCCTATCCCCATCATCTGAAGTCCTCAAGACGAAGACCAAGAAGATGAAGAACGACACCTCCGAAACCGTCGGACTCGAATCTTCAATCAAGAAAGAGAAAAAGAGCAAAAAGAATAAGACCGACACTCCTTCCGATACTGAAAAATCCGAGAAAAAAAGCAAGAAGAAACGTAAGGCTTCTTCGGATACAGATAACGAAGAAGGAAAGAGCGATACAAGCGAACTAGTCGA...

Protein

Download Protein FASTA

1217 aa · LXL04_011999|LXL04_011999|OH1004|PROTEIN

MPSLAVLPETLSPSSEVLKTKTKKMKNDTSETVGLESSIKKEKKSKKNKTDTPSDTEKSEKKSKKKRKASSDTDNEEGKSDTSELVEPVNLKIEESMKKSKKKKTKTAEVDEEVEPIKEENPNAVSNFRVSEPLRNALKAKGIEALFPIQARTFDSIYDGLDLIGKAKTGQGKTLAFILPILESLINGPEKASRKTGYGRSPTILVLLPTRELAKQVFTDFKYYGESVGLTSCCLYGGGGASISPQTMQLKRGVDIVVGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011999`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011999

Location Chr03:4447410-4453834 (-)

Description Similar to RH7: DEAD-box ATP-dependent RNA helicase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62190`	DEAD-box ATP-dependent RNA helicase 7.	No verified direct reference in this release
`At1g69500`	Involved in pollen wall development.	CYP704B1 is a long-chain fatty acid omega-hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis.2009 · DOI: 10.1104/pp.109.144469

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0520700`	DEAD-box ATP-dependent RNA helicase 7.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011999 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010584 pollen exine formation Biological Process

GO:0016070 RNA metabolic process Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G69500

ath:AT5G62190

dosa:Os09g0520700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.644

Rank 1 · LXL04_011999 · OH-1004

Cytoplasm0.135

Rank 2 · LXL04_011999 · OH-1004

Nucleus0.109

Rank 3 · LXL04_011999 · OH-1004

Mitochondrion0.076

Rank 4 · LXL04_011999 · OH-1004

Cell membrane0.067

Rank 5 · LXL04_011999 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD148-325 aa

PF00271.38Helicase_C367-470 aa

PF26142.1DD_DDX21-DDX50504-556 aa

PF08152.19GUCT559-654 aa

PF00067.28p450760-1199 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011999	`PF00270.36`	DEAD	148	325	1e-39	136.7
LXL04_011999	`PF00271.38`	Helicase_C	367	470	3.2e-26	92.4
LXL04_011999	`PF26142.1`	DD_DDX21-DDX50	504	556	8.6e-20	71.3
LXL04_011999	`PF08152.19`	GUCT	559	654	9.9e-29	100.1
LXL04_011999	`PF00067.28`	p450	760	1199	2.5e-68	231.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39189`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 7	68.624%	Swiss-Prot	weak database homology
`Q9C788`	Arabidopsis thaliana	Cytochrome P450 704B1	44.130%	Swiss-Prot	weak database homology
`Q650T9`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 7	65.121%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card