TkA02G581820 | RubberDandelionOmics

Gene overview

TkA02G581820

Reference: TK1151 Chr: Chr02 Coordinates: 150117603-150118298 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

696 bp · TkA02G581820|TK1151|cDNA

ATGGTCACCTCATCAAACTATATAACACACAAATACACAAACAATATTCATCATCCTTGTCTGCACACCCTAAGACAAACAAAAATGGCAAACAATCAGTTCATCATCATCATCACCACCATCCTCCTCTCCCTAGCCTTCCACAGCGCAACTGCAACCACCAACACCACCACCAACACCACCGCCGACCATGAGGTAGCCACCAGATATGACGACGATATGCCAATGGTTGTGGTGGAAGGAAAGGTTTATTGCCAGAC...

CDS

Download CDS FASTA

696 bp · TkA02G581820|TK1151|CDS

ATGGTCACCTCATCAAACTATATAACACACAAATACACAAACAATATTCATCATCCTTGTCTGCACACCCTAAGACAAACAAAAATGGCAAACAATCAGTTCATCATCATCATCACCACCATCCTCCTCTCCCTAGCCTTCCACAGCGCAACTGCAACCACCAACACCACCACCAACACCACCGCCGACCATGAGGTAGCCACCAGATATGACGACGATATGCCAATGGTTGTGGTGGAAGGAAAGGTTTATTGCCAGAC...

Protein

Download Protein FASTA

231 aa · TkA02G581820|TK1151|PROTEIN

MVTSSNYITHKYTNNIHHPCLHTLRQTKMANNQFIIIITTILLSLAFHSATATTNTTTNTTADHEVATRYDDDMPMVVVEGKVYCQTCGYNRPPWSTSRSGWSLSGFEPIRGARVRVICKNYKRRVSFYSAFSTDRKGYFYAELKNFKMNHLLLDHPLHACYVKLLSSPLDRCDIVSNMNNGIKGARLRFEDKVTYGRGYDQTVIYAAGPLAFRPSDCYPERDPIERDPFP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G581820`
TK1151 ID	TkA02G581820
OH-1004 ID	LXL04_012205
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.000
Protein coverage (%)	TK1151 87.879 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G581820`
Location	Chr02:150117603-150118298 (-)
Description	Similar to AGP30: Non-classical arabinogalactan protein 30
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012205` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009625 response to insect Biological Process GO:0009723 response to ethylene Biological Process GO:0009753 response to jasmonic acid Biological Process GO:2000033 regulation of seed dormancy process Biological Process GO:2000280 regulation of root development Biological Process GO:0005576 extracellular region Cellular Component GO:0005615 extracellular space Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009505 plant-type cell wall Cellular Component GO:0009506 plasmodesma Cellular Component GO:0071944 cell periphery Cellular Component
KEGG gene cross-reference	ath:AT1G28290 ath:AT1G54970 ath:AT2G33790 zma:542292 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.574

Rank 1 · TkA02G581820 · TK1151

Endoplasmic reticulum0.159

Rank 2 · TkA02G581820 · TK1151

Cytoplasm0.110

Rank 3 · TkA02G581820 · TK1151

Cell membrane0.108

Rank 4 · TkA02G581820 · TK1151

Lysosome / Vacuole0.056

Rank 5 · TkA02G581820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19144DUF582625-58 aa

PF28682TTMP_N34-51 aa

PF01190Pollen_Ole_e_178-181 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G581820	`PF19144`	DUF5826	25	58	0.32	11.9
TkA02G581820	`PF28682`	TTMP_N	34	51	0.95	9.8
TkA02G581820	`PF01190`	Pollen_Ole_e_1	78	181	1.4e-08	35.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card