TkA02G566370 | RubberDandelionOmics

Gene overview

TkA02G566370

Reference: TK1151 Chr: Chr02 Coordinates: 146312578-146314956 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1313 bp · TkA02G566370|TK1151|cDNA

CCGACAGCCTTCGGCGCTACGCATAATAATATAGATACAAAATTCTACAATGTGTTCTTCAAGACGCGATAATTTAGGAGAACAAAGAGAGGGTTATCGGCTCACGAAGAATTTGGAGGAAGGAAAGGTGAATCAAACAATATCATCAAAACCTTATCCGATCCTGATCGGATTCGACATCAAAGGGTTCTTCCACTTGGAAACAATTCAAAGTCCAGATCAGGAGTTGCAACAAACTGGTATAGATGTGGCCTCTACAT...

CDS

Download CDS FASTA

789 bp · TkA02G566370|TK1151|CDS

ATGTGGCCTCTACATATCCTTTTAAGCAAGCTCCTAAAATCAGAAGAACATGATGATCATGAAGAGGAACACAATATAAGTTTTTCTGAACCATATGATTTCAAACCATCACTGAAAAATAGGAACAAGAGTCACTCACACTTTGTGGAAGTCCCACATATAAAACAATTACGCTCATGGGATTGTGGTCTTGTTTGTGTTCTAATGATCTTAAGAACACTTGGTCTCAACCATTTTGATATTCAAGATTTAGAGGACCT...

Protein

Download Protein FASTA

262 aa · TkA02G566370|TK1151|PROTEIN

MWPLHILLSKLLKSEEHDDHEEEHNISFSEPYDFKPSLKNRNKSHSHFVEVPHIKQLRSWDCGLVCVLMILRTLGLNHFDIQDLEDLCCTTSIWTVDLAYLLQKLSIRFSYYTVTIGANPDFSVETFYKEQLANDIERVDMLFQRSVQEGIQIECRSIKGEEIIFFILSGKYVVIALVDQRILSQSWKEDVHMPQFYNSTAAYTGHYVVICGYDAHTDEFEIRDPASSRKSDRISSKCLEEARKSYGTDEDILLVSLVDT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G566370`
TK1151 ID	TkA02G566370
OH-1004 ID	LXL04_012414
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G566370

Location Chr02:146312578-146314956 (-)

Description Similar to GC1: Guanylyl cyclase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05930`	Magnesium-dependent guanylyl cyclase that catalyzes the formation of guanosine 3',5'-cyclic monophosphate (cGMP) from guanosine 5'-triphosphate (GTP).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012414 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006182 cGMP biosynthetic process Biological Process

GO:0051591 response to cAMP Biological Process

GO:0005634 nucleus Cellular Component

GO:0004383 guanylate cyclase activity Molecular Function

KEGG gene cross-reference

ath:AT5G05930

hsa:83606

mmu:68778

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.524

Rank 1 · TkA02G566370 · TK1151

Nucleus0.301

Rank 2 · TkA02G566370 · TK1151

Golgi apparatus0.122

Rank 3 · TkA02G566370 · TK1151

Endoplasmic reticulum0.119

Rank 4 · TkA02G566370 · TK1151

Mitochondrion0.108

Rank 5 · TkA02G566370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13529Peptidase_C39_250-246 aa

PF09778Guanylate_cyc_251-255 aa

PF03412Peptidase_C3951-90 aa

PF11814DUF333551-77 aa

PF11814DUF3335197-228 aa

PF12385Peptidase_C70200-232 aa

PF03412Peptidase_C39202-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G566370	`PF13529`	Peptidase_C39_2	50	246	5.4e-08	34.1
TkA02G566370	`PF09778`	Guanylate_cyc_2	51	255	2.4e-73	246.7
TkA02G566370	`PF03412`	Peptidase_C39	51	90	3.9e-06	27.4
TkA02G566370	`PF11814`	DUF3335	51	77	0.13	12.4
TkA02G566370	`PF11814`	DUF3335	197	228	0.13	12.4
TkA02G566370	`PF12385`	Peptidase_C70	200	232	0.082	13.5
TkA02G566370	`PF03412`	Peptidase_C39	202	230	3.9e-06	27.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L870`	Arabidopsis thaliana	sp\|Q8L870\|GCC1_ARATH Guanylyl cyclase 1	53.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card