TkA02G564530 | RubberDandelionOmics

Gene overview

TkA02G564530

Reference: TK1151 Chr: Chr02 Coordinates: 145791355-145792332 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

897 bp · TkA02G564530|TK1151|cDNA

ATGAGTTATCATGATATAAAGGTGGCCACCAAGAATTTCTCAGAAAACTGCATTGGTTCAGGTGGATTCGGTAAGGTATATAGAGCAGAACTCGAATATTTTGATACGATACGCAATACCGTAGCTATTAAATGTCTCTTCAAAAGAAAAGACACGCAAGCAGAAAAAGGGTTTGCTGCAGAGATTGAAATACTTTCGAGTTGTAAGCATCCCAATGTAGTCTCTCTTATTGGCTTTTGTGATGAAAAAGCATCAGACCT...

CDS

Download CDS FASTA

897 bp · TkA02G564530|TK1151|CDS

ATGAGTTATCATGATATAAAGGTGGCCACCAAGAATTTCTCAGAAAACTGCATTGGTTCAGGTGGATTCGGTAAGGTATATAGAGCAGAACTCGAATATTTTGATACGATACGCAATACCGTAGCTATTAAATGTCTCTTCAAAAGAAAAGACACGCAAGCAGAAAAAGGGTTTGCTGCAGAGATTGAAATACTTTCGAGTTGTAAGCATCCCAATGTAGTCTCTCTTATTGGCTTTTGTGATGAAAAAGCATCAGACCT...

Protein

Download Protein FASTA

298 aa · TkA02G564530|TK1151|PROTEIN

MSYHDIKVATKNFSENCIGSGGFGKVYRAELEYFDTIRNTVAIKCLFKRKDTQAEKGFAAEIEILSSCKHPNVVSLIGFCDEKASDLILVYKYASNGSLDDHLRSFVKMTNLKWEQRLQLCLDIARGLNYLHTKQNIIHRDIKSDNILLDDNMVAKIADFGLSKIGPVPQHASYIETTVAGTIVYLDPEYEITQKLKKASDIYSLGVVLFEILSGSLAYNKAYMDRNPKGLAPCVRQHFQNGTLKDMVDPKLKGNLDENS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G564530`
TK1151 ID	TkA02G564530
OH-1004 ID	LXL04_032394
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	54.300
Protein coverage (%)	TK1151 97.987 / OH-1004 23.457 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G564530

Location Chr02:145791355-145792332 (-)

Description Similar to At5g59700: Probable receptor-like protein kinase At5g59700

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51550`	May regulate MLO7 polarization in female gametophyte synergid cells to control pollen tube growth and male gamete delivery during fertilization.	FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development.2010 · DOI: 10.1073/pnas.1005366107
`At5g61350`	Probable receptor-like protein kinase At5g61350.	No verified direct reference in this release
`At5g28680`	Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell.	No verified direct reference in this release
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At3g04690`	Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032394 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0051924 regulation of calcium ion transport Biological Process

GO:0080147 root hair cell development Biological Process

GO:0097275 intracellular ammonium homeostasis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0043680 filiform apparatus Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT5G59700

ath:AT5G61350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.512

Rank 1 · TkA02G564530 · TK1151

Cytoplasm0.409

Rank 2 · TkA02G564530 · TK1151

Nucleus0.198

Rank 3 · TkA02G564530 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkA02G564530 · TK1151

Golgi apparatus0.044

Rank 5 · TkA02G564530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109ABC111-46 aa

PF07714PK_Tyr_Ser-Thr16-289 aa

PF00069Pkinase16-287 aa

PF10140YukC100-189 aa

PF12330Haspin_kinase106-166 aa

PF14531Kinase-like110-161 aa

PF03109ABC1115-167 aa

PF17667Pkinase_fungal122-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G564530	`PF03109`	ABC1	11	46	0.00044	20.2
TkA02G564530	`PF07714`	PK_Tyr_Ser-Thr	16	289	2.4e-50	172.0
TkA02G564530	`PF00069`	Pkinase	16	287	1.1e-47	163.3
TkA02G564530	`PF10140`	YukC	100	189	0.025	14.2
TkA02G564530	`PF12330`	Haspin_kinase	106	166	0.0015	18.3
TkA02G564530	`PF14531`	Kinase-like	110	161	0.074	13.0
TkA02G564530	`PF03109`	ABC1	115	167	0.00044	20.2
TkA02G564530	`PF17667`	Pkinase_fungal	122	152	0.0037	16.8
TkA02G564530	`PF01636`	APH	132	168	0.0033	17.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCZ4`	Arabidopsis thaliana	sp\|Q9SCZ4\|FERON_ARATH Receptor-like protein kinase FERONIA	43.800%	Swiss-Prot	Medium
`Q9FLJ8`	Arabidopsis thaliana	sp\|Q9FLJ8\|Y5613_ARATH Probable receptor-like protein kinase At5g61350	44.300%	Swiss-Prot	Medium
`Q3E8W4`	Arabidopsis thaliana	sp\|Q3E8W4\|ANX2_ARATH Receptor-like protein kinase ANXUR2	43.000%	Swiss-Prot	Medium
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	43.100%	Swiss-Prot	Medium
`Q9SR05`	Arabidopsis thaliana	sp\|Q9SR05\|ANX1_ARATH Receptor-like protein kinase ANXUR1	42.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card