TkA02G527490 | RubberDandelionOmics

Gene overview

TkA02G527490

Reference: TK1151 Chr: Chr02 Coordinates: 136025419-136029064 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2299 bp · TkA02G527490|TK1151|cDNA

ATTTTCCATGTTAAATCTGATAATGGGTAAACCGGTAAACTGATATCTTTTTATCGCAAAGATGAAAGATGCATTCATCTCCAAAGTCCAGCAATGACTTTCTTCACTTGGCTCTCTCGTGCTCGAACGTCCTGTAAACCTACCAAATTCTTCCAAAACGCCTTCCTTCATCCCAATAACACTGCTAGAACTCAATTTCAATCTCAATCACGCAGTCTAGACAGCTCCATCATAGTCAACTCGAACTACAGCAGCAAACA...

CDS

Download CDS FASTA

1728 bp · TkA02G527490|TK1151|CDS

ATGACTTTCTTCACTTGGCTCTCTCGTGCTCGAACGTCCTGTAAACCTACCAAATTCTTCCAAAACGCCTTCCTTCATCCCAATAACACTGCTAGAACTCAATTTCAATCTCAATCACGCAGTCTAGACAGCTCCATCATAGTCAACTCGAACTACAGCAGCAAACAATCATGGAGGACTTATTTGCTTCCCATTGTTCTCACCGTCTCCGGCGGCTCACTTGCCCTACAGTTACCGAAAAACCCATCCCTATGCGATGC...

Protein

Download Protein FASTA

575 aa · TkA02G527490|TK1151|PROTEIN

MTFFTWLSRARTSCKPTKFFQNAFLHPNNTARTQFQSQSRSLDSSIIVNSNYSSKQSWRTYLLPIVLTVSGGSLALQLPKNPSLCDAPSLQERSGRIGGKDSTEPIVKGTYKPVPPELISELKAICQDNMTLDYDERYFHGKPQYSFHKAVNIPDVVVFPRSEDEVSKIVRSCNKHKVPIVPYGGATSIEGHTLSPNGGVCIDMTLMKSVKALHVEDMDVVVEPGIGWMELNEYLAPYGLFFPLDPGPGATIGGMCGTRC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G527490`
TK1151 ID	TkA02G527490
OH-1004 ID	LXL04_013794
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	28.400
Protein coverage (%)	TK1151 73.565 / OH-1004 75.844 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G527490

Location Chr02:136025419-136029064 (+)

Description Similar to D2HGDH: D-2-hydroxyglutarate dehydrogenase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06580`	Catalyzes the stereospecific oxidation of D-lactate to pyruvate.	Two D-2-hydroxy-acid dehydrogenases in Arabidopsis thaliana with catalytic capacities to participate in the last reactions of the methylglyoxal and beta-oxidation pathways.2009 · DOI: 10.1074/jbc.m109.021253

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013794 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006089 lactate metabolic process Biological Process

GO:0006103 2-oxoglutarate metabolic process Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0009853 photorespiration Biological Process

GO:0010042 response to manganese ion Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0010230 alternative respiration Biological Process

GO:0031648 protein destabilization Biological Process

GO:0032025 response to cobalt ion Biological Process

GO:1901275 tartrate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

KEGG gene cross-reference

ath:AT4G36400

dre:565889

hsa:728294

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.908

Rank 1 · TkA02G527490 · TK1151

Cytoplasm0.070

Rank 2 · TkA02G527490 · TK1151

Nucleus0.042

Rank 3 · TkA02G527490 · TK1151

Plastid0.041

Rank 4 · TkA02G527490 · TK1151

Cell membrane0.027

Rank 5 · TkA02G527490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01565FAD_binding_4154-290 aa

PF02913FAD-oxidase_C280-328 aa

PF02913FAD-oxidase_C327-568 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G527490	`PF01565`	FAD_binding_4	154	290	6.4e-38	130.3
TkA02G527490	`PF02913`	FAD-oxidase_C	280	328	1.4e-70	238.6
TkA02G527490	`PF02913`	FAD-oxidase_C	327	568	1.4e-70	238.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AX4`	Arabidopsis thaliana	sp\|Q94AX4\|DLD_ARATH D-lactate dehydrogenase [cytochrome], mitochondrial	78.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card