TkA02G520000 | RubberDandelionOmics

Gene overview

TkA02G520000

Reference: TK1151 Chr: Chr02 Coordinates: 134063270-134066594 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2057 bp · TkA02G520000|TK1151|cDNA

GAGAAATCATTCGCCCAAAGGCCCTTTTGGCACTAAACAATCACAAACACAAGCGACTGATCGCGAGTATCTCGAATCAACTACTGAGGCGTTTGAATTCGTTGAGCATGAGATCTATCTTCGCCTTTCTTGGCGACATAAATTAAGCTTGATTTTCCCTCCGCCATAGCGCTGCGGTGCCATTGAGCTGTTGTACGTTTGTCTTTGAGACTTTCGAGGTTAATTTGAAATTTTGAATGTAATTTGGGAACCCGCAGTGA...

CDS

Download CDS FASTA

1410 bp · TkA02G520000|TK1151|CDS

ATGGATAATGCTCTGAGATTAGCTTTGTTGCTGGTGCTTATTGCTAAAGTTTATCCATCTTCTAGTGCGTATGAGTTTGAGCATTGCAAGAATACGGTCAAGCAATGGGCGTCTTCATCTCTTCACTCCAATATCAAGGATGGGCACATTCTGCAGGACTTGTTGTTCTTCCTTCATGTCCCAAGAACAGGAGGACGAACGTACTTCTATTGCTTTTTGAAGAAACTGTACTCTAGCTCTCTCGAATGCCCACGATCTTA...

Protein

Download Protein FASTA

469 aa · TkA02G520000|TK1151|PROTEIN

MDNALRLALLLVLIAKVYPSSSAYEFEHCKNTVKQWASSSLHSNIKDGHILQDLLFFLHVPRTGGRTYFYCFLKKLYSSSLECPRSYDKLRFDPRKQNCRLLATHDDYSIMSKLPREKSSVVTILRNPIDRVFSAYEFSIEVAARFLVHPNLTSATKMPANSRSKKGVISTLDIWPWKYLVPWMREELFTKRDARKRKGPPYAYGDDSYNMEEIVTPLHEFINHPVALDLVHNGATFQIAGLTNNSNVWRVHEVRHCVMT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G520000`
TK1151 ID	TkA02G520000
OH-1004 ID	LXL04_013051
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G520000

Location Chr02:134063270-134066594 (+)

Description Similar to TPST: Protein-tyrosine sulfotransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08030`	Catalyzes the O-sulfation of tyrosine residues within acidic motifs of polypeptides.	Identification of tyrosylprotein sulfotransferase in Arabidopsis.2009 · DOI: 10.1073/pnas.0902801106

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013051 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009733 response to auxin Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010366 negative regulation of ethylene biosynthetic process Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0015012 heparan sulfate proteoglycan biosynthetic process Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0045087 innate immune response Biological Process

GO:0055070 copper ion homeostasis Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

KEGG gene cross-reference

ath:AT1G08030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.787

Rank 1 · TkA02G520000 · TK1151

Endoplasmic reticulum0.115

Rank 2 · TkA02G520000 · TK1151

Cytoplasm0.095

Rank 3 · TkA02G520000 · TK1151

Cell membrane0.056

Rank 4 · TkA02G520000 · TK1151

Extracellular0.036

Rank 5 · TkA02G520000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23695YncO9-34 aa

PF03567Sulfotransfer_254-162 aa

PF00685Sulfotransfer_194-142 aa

PF03567Sulfotransfer_2329-398 aa

PF00685Sulfotransfer_1329-348 aa

PF23695YncO440-458 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G520000	`PF23695`	YncO	9	34	5.9	7.6
TkA02G520000	`PF03567`	Sulfotransfer_2	54	162	9.3e-05	23.4
TkA02G520000	`PF00685`	Sulfotransfer_1	94	142	0.002	18.3
TkA02G520000	`PF03567`	Sulfotransfer_2	329	398	9.3e-05	23.4
TkA02G520000	`PF00685`	Sulfotransfer_1	329	348	0.002	18.3
TkA02G520000	`PF23695`	YncO	440	458	5.9	7.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EDG5`	Arabidopsis thaliana	sp\|Q3EDG5\|TPST_ARATH Protein-tyrosine sulfotransferase	54.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card