TkA02G470630 | RubberDandelionOmics

Gene overview

TkA02G470630

Reference: TK1151 Chr: Chr02 Coordinates: 120067833-120073148 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3791 bp · TkA02G470630|TK1151|cDNA

GTAATTTTTCATTTTAGGATGATAGATTAGATGAAAACTTAAACATGATATTTTACAAAGTTGATGTAATGTACATTTCTTTTGAATGGACATAAAATTCAAGGAAAATGGTTTAGGATACATGATGATAAATAACGCGGCAATTATTCAGTTACAGTTCGTGTTTTTGTTTTAATCCAGTCGTTAACACCGACGCCAAATCCCAAAATCGATTTGATTCCTAAATTTGAATTTGTTTCTATCAGCATCAGCATCATTAT...

CDS

Download CDS FASTA

2085 bp · TkA02G470630|TK1151|CDS

ATGGGGGAAAACGGTGGTAGTGGAGGAGGGGGGACGCGATCAGGGGACAGTGGTACCCGCCATGACGAGAGGATTTTTGTGTCTGTGCGGCTGCGACCTTTGAATGGAAGAGAAATTGTCACGAGCGATGTGTCTGATTGGGAATGTATCGGTCAAAACACAATCGCTTACAAGAATGGAAGCCTTGGTGTTCCGGAGAGATCCATGTACCCGTCGGCATATACATTCGACAGGGTTTTTGGCTACGATTGCTCCACACG...

Protein

Download Protein FASTA

694 aa · TkA02G470630|TK1151|PROTEIN

MGENGGSGGGGTRSGDSGTRHDERIFVSVRLRPLNGREIVTSDVSDWECIGQNTIAYKNGSLGVPERSMYPSAYTFDRVFGYDCSTRQVYQDGAKDVVLSVVGGINASIFAYGQTSSGKTFTMTGITEYTLADIYDYVQKHPERDFHLKFSAMEIYNESVRDLLSSDGYPLRLLDDPERGTIVENLTDESIRDWDHMMELLSICEAQRQSGETSLNETSSRSHQIIRLTIESTPSNYLGRDSATTLVSTVNFVDLAGSER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G470630`
TK1151 ID	TkA02G470630
OH-1004 ID	LXL04_013811
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 92.795 / OH-1004 67.435 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G470630

Location Chr02:120067833-120073148 (-)

Description Similar to KIN7E: Kinesin-like protein KIN-7E

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66310`	Kinesin-like protein KIN-7H.	No verified direct reference in this release
`At3g51150`	Kinesin-like protein KIN-7G.	No verified direct reference in this release
`At4g38950`	Kinesin-like protein KIN-7F.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0538800`	Binds ATP/ADP in vitro.	No verified direct reference in this release
`Os08g0547500`	Kinesin-like protein KIN-7H.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013811 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT2G21300

ath:AT3G51150

ath:AT5G66310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.687

Rank 1 · TkA02G470630 · TK1151

Nucleus0.308

Rank 2 · TkA02G470630 · TK1151

Cell membrane0.104

Rank 3 · TkA02G470630 · TK1151

Mitochondrion0.045

Rank 4 · TkA02G470630 · TK1151

Golgi apparatus0.040

Rank 5 · TkA02G470630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00225Kinesin30-349 aa

PF16796Microtub_bd65-164 aa

PF04344CheZ305-415 aa

PF16559GIT_CC354-378 aa

PF04977DivIC354-378 aa

PF27821CEP162_helical_3364-424 aa

PF04977DivIC396-427 aa

PF15996PNISR397-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G470630	`PF00225`	Kinesin	30	349	3.7e-98	329.2
TkA02G470630	`PF16796`	Microtub_bd	65	164	1.2e-18	68.2
TkA02G470630	`PF04344`	CheZ	305	415	0.13	12.9
TkA02G470630	`PF16559`	GIT_CC	354	378	0.017	15.5
TkA02G470630	`PF04977`	DivIC	354	378	3.8	8.1
TkA02G470630	`PF27821`	CEP162_helical_3	364	424	5.5	7.9
TkA02G470630	`PF04977`	DivIC	396	427	3.8	8.1
TkA02G470630	`PF15996`	PNISR	397	447	4.3	8.3
TkA02G470630	`PF16559`	GIT_CC	401	422	0.017	15.5
TkA02G470630	`PF15996`	PNISR	563	633	4.3	8.3
TkA02G470630	`PF27821`	CEP162_helical_3	580	628	5.5	7.9
TkA02G470630	`PF16796`	Microtub_bd	584	614	1.2e-18	68.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JZ68`	Arabidopsis thaliana	sp\|F4JZ68\|KN7H_ARATH Kinesin-like protein KIN-7H	62.600%	Swiss-Prot	High
`F4J394`	Arabidopsis thaliana	sp\|F4J394\|KN7G_ARATH Kinesin-like protein KIN-7G	56.500%	Swiss-Prot	High
`F4JUI9`	Arabidopsis thaliana	sp\|F4JUI9\|KN7F_ARATH Kinesin-like protein KIN-7F	55.400%	Swiss-Prot	High
`Q7X7H4`	Oryza sativa subsp. japonica	sp\|Q7X7H4\|KN7F_ORYSJ Kinesin-like protein KIN-7F	57.900%	Swiss-Prot	High
`Q6Z9D2`	Oryza sativa subsp. japonica	sp\|Q6Z9D2\|KN7H_ORYSJ Kinesin-like protein KIN-7H	69.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card