TkA02G460120 | RubberDandelionOmics

Gene overview

TkA02G460120

Reference: TK1151 Chr: Chr02 Coordinates: 117238389-117243230 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1847 bp · TkA02G460120|TK1151|cDNA

TTCCAATAAAGACCTCTGCATTTTGTATTTTGGTCCTCTTCCATATTTCTGTGTCTTCTCTCCCGTATTGTTTGGCTATATAAATGCTCGTCCCACGATCTCCTTCTTCCACATTCAACTGCTCCCTATCTCCTCCTCTCTCACACACAGAAACACACACAGAAACACAGTGAAACAACAAGCATGGTGTTATCGAGGGCCGTGTCGGAGACCGATGCCTCCTTGCACTCGACCTTCGCTTCTCGATATGTACGCGCAGT...

CDS

Download CDS FASTA

1170 bp · TkA02G460120|TK1151|CDS

ATGGTGTTATCGAGGGCCGTGTCGGAGACCGATGCCTCCTTGCACTCGACCTTCGCTTCTCGATATGTACGCGCAGTTCTTCCAAGGTTTAAGATGCCGGAAAATTCGATTCCAAAGGAGGCAGCGTATCAGATAATAAACGATGAGCTGATGTTGGACGGGAATCCGAGGCTGAATCTAGCGTCGTTCGTGACGACATGGATGGAGCCGGAATGTGATAAGCTAATCATGTCTTCCATTAACAAGAATTACGTTGACAT...

Protein

Download Protein FASTA

389 aa · TkA02G460120|TK1151|PROTEIN

MVLSRAVSETDASLHSTFASRYVRAVLPRFKMPENSIPKEAAYQIINDELMLDGNPRLNLASFVTTWMEPECDKLIMSSINKNYVDMDEYPVTTELQNRCVNMIAHLFNAPLGETETAVGVGTVGSSEAIMLAGLAFKRRWQNKMREQGKPFDKPNIVTGANVQVCWEKFARYFEVELKEVKLREDYYVMDPEKAVEMVDENTICVAAILGSTLNGEFEDVKRLNDLLVEKNSETGWDTPIHVDAASGGFIAPFIYPELE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G460120`
TK1151 ID	TkA02G460120
OH-1004 ID	LXL04_013962
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.000
Protein coverage (%)	TK1151 96.144 / OH-1004 75.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G460120

Location Chr02:117238389-117243230 (-)

Description Similar to GAD1: Glutamate decarboxylase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17330`	Catalyzes the conversion of glutamate to 4-aminobutanoate (GABA).	Two isoforms of glutamate decarboxylase in Arabidopsis are regulated by calcium/calmodulin and differ in organ distribution.1998 · DOI: 10.1023/a:1006047623263
`At2g02010`	Catalyzes the production of GABA.	No verified direct reference in this release
`At1g65960`	Catalyzes the conversion of glutamate to 4-aminobutanoate (GABA).	Two isoforms of glutamate decarboxylase in Arabidopsis are regulated by calcium/calmodulin and differ in organ distribution.1998 · DOI: 10.1023/a:1006047623263 Characterization of two glutamate decarboxylase cDNA clones from Arabidopsis.1998 · DOI: 10.1104/pp.117.4.1411
`At3g17760`	Catalyzes the production of GABA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013962 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006536 glutamate metabolic process Biological Process

GO:0006538 L-glutamate catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004351 glutamate decarboxylase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0060090 molecular adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT1G65960

ath:AT2G02000

ath:AT2G02010

ath:AT5G17330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA02G460120 · TK1151

Nucleus0.295

Rank 2 · TkA02G460120 · TK1151

Mitochondrion0.170

Rank 3 · TkA02G460120 · TK1151

Endoplasmic reticulum0.111

Rank 4 · TkA02G460120 · TK1151

Cell membrane0.110

Rank 5 · TkA02G460120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00282Pyridoxal_deC33-371 aa

PF00266Aminotran_5161-295 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G460120	`PF00282`	Pyridoxal_deC	33	371	1.6e-104	350.3
TkA02G460120	`PF00266`	Aminotran_5	161	295	0.00042	20.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42521`	Arabidopsis thaliana	sp\|Q42521\|DCE1_ARATH Glutamate decarboxylase 1	88.800%	Swiss-Prot	High
`Q9ZPS3`	Arabidopsis thaliana	sp\|Q9ZPS3\|DCE4_ARATH Glutamate decarboxylase 4	86.400%	Swiss-Prot	High
`Q42472`	Arabidopsis thaliana	sp\|Q42472\|DCE2_ARATH Glutamate decarboxylase 2	83.400%	Swiss-Prot	High
`Q9LSH2`	Arabidopsis thaliana	sp\|Q9LSH2\|DCE5_ARATH Glutamate decarboxylase 5	85.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card