LXL04_013962 | RubberDandelionOmics

Gene overview

LXL04_013962

Reference: OH-1004 Chr: Chr03 Coordinates: 39290959-39295664 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1482 bp · LXL04_013962|LXL04_013962|OH1004|cDNA

ATGGTGTTATCGAGTGCTGTGTCGGAGACCGATGCCTCCTTGCACTCGACCTTCGCTTCTCGATATGTACGCACAGTTCTTCCAAGGTTTAAGATGCCGGAAAATTCGATTCCAAAGGAGGCAGCGTATCAGATAATAAACGATGAGCTGATGTTGGACGGGAATCCAAGGCTGAATCTAGCGTCGTTCGTGACGACATGGATGGAGCCGGAATGTGACAAGCTAATCATGTCTTCCATTAATAAGAATTACGTTGACAT...

CDS

Download CDS FASTA

1482 bp · LXL04_013962|LXL04_013962|OH1004|CDS

ATGGTGTTATCGAGTGCTGTGTCGGAGACCGATGCCTCCTTGCACTCGACCTTCGCTTCTCGATATGTACGCACAGTTCTTCCAAGGTTTAAGATGCCGGAAAATTCGATTCCAAAGGAGGCAGCGTATCAGATAATAAACGATGAGCTGATGTTGGACGGGAATCCAAGGCTGAATCTAGCGTCGTTCGTGACGACATGGATGGAGCCGGAATGTGACAAGCTAATCATGTCTTCCATTAATAAGAATTACGTTGACAT...

Protein

Download Protein FASTA

493 aa · LXL04_013962|LXL04_013962|OH1004|PROTEIN

MVLSSAVSETDASLHSTFASRYVRTVLPRFKMPENSIPKEAAYQIINDELMLDGNPRLNLASFVTTWMEPECDKLIMSSINKNYVDMDEYPVTTELQNRCVNMIAHLFNAPLGETETAVGVGTVGSSEAIMLAGLAFKRRWQNKMREQGKPFDKPNIVTGANVQVCWEKFARYFEVELKEVKLREDYYVMDPEKAVEMVDENTICVAAILGSTLNGEFEDVKRLNDLLVEKNAETGWDTPIHVDAASGGFIAPFIYPELE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013962`
TK1151 ID	TkA02G460120
OH-1004 ID	LXL04_013962
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.000
Protein coverage (%)	TK1151 96.144 / OH-1004 75.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013962

Location Chr03:39290959-39295664 (+)

Description Similar to GAD1: Glutamate decarboxylase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17330`	Catalyzes the conversion of glutamate to 4-aminobutanoate (GABA).	Two isoforms of glutamate decarboxylase in Arabidopsis are regulated by calcium/calmodulin and differ in organ distribution.1998 · DOI: 10.1023/a:1006047623263
`At2g02010`	Catalyzes the production of GABA.	No verified direct reference in this release
`At1g65960`	Catalyzes the conversion of glutamate to 4-aminobutanoate (GABA).	Two isoforms of glutamate decarboxylase in Arabidopsis are regulated by calcium/calmodulin and differ in organ distribution.1998 · DOI: 10.1023/a:1006047623263 Characterization of two glutamate decarboxylase cDNA clones from Arabidopsis.1998 · DOI: 10.1104/pp.117.4.1411
`At2g02000`	Catalyzes the production of GABA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013962 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006536 glutamate metabolic process Biological Process

GO:0006538 L-glutamate catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004351 glutamate decarboxylase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0060090 molecular adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT1G65960

ath:AT2G02000

ath:AT2G02010

ath:AT5G17330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.624

Rank 1 · LXL04_013962 · OH-1004

Nucleus0.307

Rank 2 · LXL04_013962 · OH-1004

Cell membrane0.122

Rank 3 · LXL04_013962 · OH-1004

Mitochondrion0.104

Rank 4 · LXL04_013962 · OH-1004

Endoplasmic reticulum0.099

Rank 5 · LXL04_013962 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00282.26Pyridoxal_deC33-381 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013962	`PF00282.26`	Pyridoxal_deC	33	381	7.4e-110	367.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42521`	Arabidopsis thaliana	Glutamate decarboxylase 1	84.861%	Swiss-Prot	strong database homology
`Q9ZPS3`	Arabidopsis thaliana	Glutamate decarboxylase 4	83.573%	Swiss-Prot	strong database homology
`Q42472`	Arabidopsis thaliana	Glutamate decarboxylase 2	82.020%	Swiss-Prot	strong database homology
`Q9ZPS4`	Arabidopsis thaliana	Glutamate decarboxylase 3	79.675%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card