TkA02G458680 | RubberDandelionOmics

Gene overview

TkA02G458680

Reference: TK1151 Chr: Chr02 Coordinates: 116848660-116849064 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

405 bp · TkA02G458680|TK1151|cDNA

ATGAACATGAACCAGGTGGTAAAGAACCGGTTCTCATGGCGGCTGGCAGGTCTAATGGTGGTGGTGATGTTCCTATCGACGGCCAAGCCGGCGACATCACAGTCTAACAGGAACAACACTCTGATGAGATATTACTGCAGTCAATATTACGGTATGAACGAGACGTATTTCTACCAGAATCTCAACACCACCATTTCTACCCTCCGCCGGCAGTTGTTGGTTACACGCTATGCCCTCGCCCGTACTCTGCTGAACGGAGA...

CDS

Download CDS FASTA

405 bp · TkA02G458680|TK1151|CDS

ATGAACATGAACCAGGTGGTAAAGAACCGGTTCTCATGGCGGCTGGCAGGTCTAATGGTGGTGGTGATGTTCCTATCGACGGCCAAGCCGGCGACATCACAGTCTAACAGGAACAACACTCTGATGAGATATTACTGCAGTCAATATTACGGTATGAACGAGACGTATTTCTACCAGAATCTCAACACCACCATTTCTACCCTCCGCCGGCAGTTGTTGGTTACACGCTATGCCCTCGCCCGTACTCTGCTGAACGGAGA...

Protein

Download Protein FASTA

134 aa · TkA02G458680|TK1151|PROTEIN

MNMNQVVKNRFSWRLAGLMVVVMFLSTAKPATSQSNRNNTLMRYYCSQYYGMNETYFYQNLNTTISTLRRQLLVTRYALARTLLNGESVWGLATCQGYVSTPNCVACFDYAVAQFRVCGRGNGAHAFYNDCDVR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G458680`
TK1151 ID	TkA02G458680
OH-1004 ID	LXL04_013987
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.000
Protein coverage (%)	TK1151 55.970 / OH-1004 10.108 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G458680`
Location	Chr02:116848660-116849064 (+)
Description	Similar to CRK3: Cysteine-rich receptor-like protein kinase 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013987` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006468 protein phosphorylation Biological Process GO:0006979 response to oxidative stress Biological Process GO:0007165 signal transduction Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0010193 response to ozone Biological Process GO:0042742 defense response to bacterium Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0052545 callose localization Biological Process GO:0072593 reactive oxygen species metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference	ath:AT1G19090 ath:AT1G70520 ath:AT1G70530 ath:AT4G05200 ath:AT5G40380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.534

Rank 1 · TkA02G458680 · TK1151

Extracellular0.243

Rank 2 · TkA02G458680 · TK1151

Endoplasmic reticulum0.101

Rank 3 · TkA02G458680 · TK1151

Cytoplasm0.076

Rank 4 · TkA02G458680 · TK1151

Nucleus0.026

Rank 5 · TkA02G458680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17831PDH_E1_M30-91 aa

PF01657Stress-antifung49-134 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G458680	`PF17831`	PDH_E1_M	30	91	0.02	15.0
TkA02G458680	`PF01657`	Stress-antifung	49	134	1.1e-08	36.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card