RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G444880
Reference: TK1151 Chr: Chr02 Coordinates: 113031386-113033555 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1218 bp · TkA02G444880|TK1151|cDNA

TTTTACTTCCGCTCATGGATTCTATTTTCCACTGCAAGGAATTCATTCCTTTGGACGAAGGAAAATAACAAAAAGTCCAAAATGCCCTCAATAAAAATGTTAAATTAAGAAACAACCCTACTAACAAAAATCGGCCGCTCGCTTCTTCCTCACACATCGCGACCGCCATAGCTGCTGCTCACTTCTTCCTCACTGCATCGCGACCGCCATCGGCATAGCTCCCTCTTTCTCGGCCGACATCCATCCGAAGTTCCTCTATT...

CDS

Download CDS FASTA

780 bp · TkA02G444880|TK1151|CDS

ATGCAACTGGATGAAAAACCACAATCAGGAGACGAGTCAAACCCCTACCTAAGCAAGTCAACTCGCCTCCCAAGAAAACGCTTTTATAGAGCTCGGGCCCACAGCAACCCCTTAAGCGATTCCCATTTCCCAGTTCCAATCTCCCCTCACCATGTAAACCTCTCCCTTCACTACCCTCACTTCTTCCCCAATTCCGATTCCGATTCCGATTCCAGAAAGATTGAATTTGCGGACATTGGGTGCGGATTCGGAGGCCTTCT...

Protein

Download Protein FASTA

259 aa · TkA02G444880|TK1151|PROTEIN

MQLDEKPQSGDESNPYLSKSTRLPRKRFYRARAHSNPLSDSHFPVPISPHHVNLSLHYPHFFPNSDSDSDSRKIEFADIGCGFGGLLISLATLFPNTLMIGMELRDKVTEYVKERILALRISNPTQYQNVSVVRTNSMKYIPNYFQKSQLSKMFFLFPDPHFKEKNHRRRVISPFLLDEYAYVIKDGGIIYTITDVEELGEWMKSCLENHPLFEGLSDEELETDPVVKLLSCATEEGQKVERNGGQTFRAVYRRIVPKV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G444880
TK1151 IDTkA02G444880
OH-1004 IDLXL04_014251
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)98.500
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G444880
LocationChr02:113031386-113033555 (-)
DescriptionSimilar to At5g24840: tRNA (guanine-N(7)-)-methyltransferase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g24840 Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2YB34 Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA. No verified direct reference in this release
Os06g0236900 Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014251 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006400 tRNA modification Biological Process
GO:0030488 tRNA methylation Biological Process
GO:0036265 RNA (guanine-N7)-methylation Biological Process
GO:0106004 tRNA (guanine-N7)-methylation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0043527 tRNA methyltransferase complex Cellular Component
GO:0106143 tRNA (m7G46) methyltransferase complex Cellular Component
GO:0000049 tRNA binding Molecular Function
GO:0008176 tRNA (guanine(46)-N7)-methyltransferase activity Molecular Function
GO:0160090 internal mRNA (guanine-N7-)-methyltransferase activity Molecular Function
KEGG gene cross-reference
ath:AT5G24840
xla:414654
zma:100280508
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.620
Rank 1 · TkA02G444880 · TK1151
Cytoplasm0.614
Rank 2 · TkA02G444880 · TK1151
Mitochondrion0.060
Rank 3 · TkA02G444880 · TK1151
Endoplasmic reticulum0.024
Rank 4 · TkA02G444880 · TK1151
Cell membrane0.022
Rank 5 · TkA02G444880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13649Methyltransf_2525-49 aa
PF13679Methyltransf_3268-138 aa
PF13847Methyltransf_3174-121 aa
PF02390Methyltransf_475-249 aa
PF08123DOT175-115 aa
PF13649Methyltransf_2578-121 aa
PF29244Methyltransf_ANTKMT78-137 aa
PF08242Methyltransf_1278-128 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G444880PF13649Methyltransf_2525490.0008120.8
TkA02G444880PF13679Methyltransf_32681380.06413.9
TkA02G444880PF13847Methyltransf_31741210.02515.1
TkA02G444880PF02390Methyltransf_4752496.3e-50169.7
TkA02G444880PF08123DOT1751150.2611.5
TkA02G444880PF13649Methyltransf_25781210.0008120.8
TkA02G444880PF29244Methyltransf_ANTKMT781370.002519.0
TkA02G444880PF08242Methyltransf_12781280.01117.1
TkA02G444880PF04278Tic221301540.3211.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GXB7Arabidopsis thalianasp|Q8GXB7|TRMB_ARATH tRNA (guanine-N(7)-)-methyltransferase80.500%Swiss-ProtHigh
A2YB34Oryza sativa subsp. indicasp|A2YB34|TRMB_ORYSI tRNA (guanine-N(7)-)-methyltransferase77.400%Swiss-ProtHigh
Q67V78Oryza sativa subsp. japonicasp|Q67V78|TRMB_ORYSJ tRNA (guanine-N(7)-)-methyltransferase77.400%Swiss-ProtHigh

JBrowse

View in Genome Browser