LXL04_014251 | RubberDandelionOmics

Gene overview

LXL04_014251

Reference: OH-1004 Chr: Chr03 Coordinates: 44542396-44543175 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

780 bp · LXL04_014251|LXL04_014251|OH1004|cDNA

ATGCAACTGGATGAAAAACCACAATCAGGAGACGAGTCAAACCCCTACCTAAGCAAGTCAACTCGCCTCCCAAGAAAACGCTTTTATAGAGCTCGGGCCCACAGCAACCCCTTAAGCGATTCCCATTTCCCAGTTCCAATCTCCCCTCACCATGTAAACCATTCCCTTCACTACCCTCACTTCTTCCCCAATTCCAATTCCGATTCCGATTCCAGAAAGATTGAATTTGCGGACATTGGGTGCGGATTCGGAGGCCTTCT...

CDS

Download CDS FASTA

780 bp · LXL04_014251|LXL04_014251|OH1004|CDS

ATGCAACTGGATGAAAAACCACAATCAGGAGACGAGTCAAACCCCTACCTAAGCAAGTCAACTCGCCTCCCAAGAAAACGCTTTTATAGAGCTCGGGCCCACAGCAACCCCTTAAGCGATTCCCATTTCCCAGTTCCAATCTCCCCTCACCATGTAAACCATTCCCTTCACTACCCTCACTTCTTCCCCAATTCCAATTCCGATTCCGATTCCAGAAAGATTGAATTTGCGGACATTGGGTGCGGATTCGGAGGCCTTCT...

Protein

Download Protein FASTA

259 aa · LXL04_014251|LXL04_014251|OH1004|PROTEIN

MQLDEKPQSGDESNPYLSKSTRLPRKRFYRARAHSNPLSDSHFPVPISPHHVNHSLHYPHFFPNSNSDSDSRKIEFADIGCGFGGLLISLATLFPNTLMIGMELRDKVTEYVKERILALRISNPTQYQNVSVVRTNSMKYIPNYFQKSQLSKMFFLFPDPHFKEKNHRRRVISPFLLDEYAYVIKDGGIIYTITDVEELGEWMKSCLENHPLFEGLSDEELEADPVVKLLSCATEEGQKVERNGGQTFRAVYRRIVPTV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014251`
TK1151 ID	TkA02G444880
OH-1004 ID	LXL04_014251
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014251

Location Chr03:44542396-44543175 (+)

Description Similar to At5g24840: tRNA (guanine-N(7)-)-methyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24840`	Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0236900`	Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA.	No verified direct reference in this release
`UniProt: A2YB34`	Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014251 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006400 tRNA modification Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0036265 RNA (guanine-N7)-methylation Biological Process

GO:0106004 tRNA (guanine-N7)-methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0043527 tRNA methyltransferase complex Cellular Component

GO:0106143 tRNA (m7G46) methyltransferase complex Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0008176 tRNA (guanine(46)-N7)-methyltransferase activity Molecular Function

GO:0160090 internal mRNA (guanine-N7-)-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G24840

xla:414654

zma:100280508

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.626

Rank 1 · LXL04_014251 · OH-1004

Cytoplasm0.605

Rank 2 · LXL04_014251 · OH-1004

Mitochondrion0.060

Rank 3 · LXL04_014251 · OH-1004

Endoplasmic reticulum0.025

Rank 4 · LXL04_014251 · OH-1004

Cell membrane0.022

Rank 5 · LXL04_014251 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02390.24Methyltransf_475-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014251	`PF02390.24`	Methyltransf_4	75	249	4.4e-50	170.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXB7`	Arabidopsis thaliana	tRNA (guanine-N(7)-)-methyltransferase	80.498%	Swiss-Prot	strong database homology
`Q67V78`	Oryza sativa subsp. japonica	tRNA (guanine-N(7)-)-methyltransferase	77.406%	Swiss-Prot	strong database homology
`A2YB34`	Oryza sativa subsp. indica	tRNA (guanine-N(7)-)-methyltransferase	77.406%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card