TkA02G441110 | RubberDandelionOmics

Gene overview

TkA02G441110

Reference: TK1151 Chr: Chr02 Coordinates: 112122511-112125577 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1251 bp · TkA02G441110|TK1151|cDNA

ATGAATTTGGCACTCTTAGCTAAATGGATATGGAGGCTTAAAACGGAAAGAAATAATCTTTGGTCGAGGTGCATCACAGCTTGGCACAAGGTCAGCCATATAGATGGGAAGGCTATTGCAAAAGCATCTTTAAAAGCTGTATGGGGAAACATTGCAGGTATAAAGATGGATTTGGACGTTTTAAACTTTAATATCGACGACCATATGACCAGGCAGATAGGAGATGGAAAAAACACGTTCTTTTGGAAGGACATTTGGAT...

CDS

Download CDS FASTA

1251 bp · TkA02G441110|TK1151|CDS

ATGAATTTGGCACTCTTAGCTAAATGGATATGGAGGCTTAAAACGGAAAGAAATAATCTTTGGTCGAGGTGCATCACAGCTTGGCACAAGGTCAGCCATATAGATGGGAAGGCTATTGCAAAAGCATCTTTAAAAGCTGTATGGGGAAACATTGCAGGTATAAAGATGGATTTGGACGTTTTAAACTTTAATATCGACGACCATATGACCAGGCAGATAGGAGATGGAAAAAACACGTTCTTTTGGAAGGACATTTGGAT...

Protein

Download Protein FASTA

416 aa · TkA02G441110|TK1151|PROTEIN

MNLALLAKWIWRLKTERNNLWSRCITAWHKVSHIDGKAIAKASLKAVWGNIAGIKMDLDVLNFNIDDHMTRQIGDGKNTFFWKDIWIGDKRLKEEFPELYKQENNKDCKVHQRLWWDEEEGLVRETWEWKRQLRNGKEKASLTEIQQKIQTITLKEQPDSWKWKEGIDGNFSVRSMRTLMDVRNEGNATAGNATEKFDWISWIPSKGEEDIDHAFFTCNHARKVWTWFAQLPNEGPELSHLIVGFLGAGVEEDEISALAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G441110`
TK1151 ID	TkA02G441110
OH-1004 ID	LXL04_017140
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	42.800
Protein coverage (%)	TK1151 54.808 / OH-1004 20.474 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G441110`
Location	Chr02:112122511-112125577 (-)
Description	Similar to At1g65750: Putative ribonuclease H protein At1g65750
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017140` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005739 mitochondrion Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.573

Rank 1 · TkA02G441110 · TK1151

Nucleus0.346

Rank 2 · TkA02G441110 · TK1151

Cell membrane0.131

Rank 3 · TkA02G441110 · TK1151

Mitochondrion0.078

Rank 4 · TkA02G441110 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA02G441110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15835DUF471555-125 aa

PF10906Mrx793-118 aa

PF13966zf-RVT205-225 aa

PF02627CMD242-275 aa

PF02627CMD294-330 aa

PF13966zf-RVT328-353 aa

PF10906Mrx7356-381 aa

PF15835DUF4715364-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G441110	`PF15835`	DUF4715	55	125	0.089	13.6
TkA02G441110	`PF10906`	Mrx7	93	118	0.018	15.9
TkA02G441110	`PF13966`	zf-RVT	205	225	0.013	16.8
TkA02G441110	`PF02627`	CMD	242	275	0.0064	17.2
TkA02G441110	`PF02627`	CMD	294	330	0.0064	17.2
TkA02G441110	`PF13966`	zf-RVT	328	353	0.013	16.8
TkA02G441110	`PF10906`	Mrx7	356	381	0.018	15.9
TkA02G441110	`PF15835`	DUF4715	364	388	0.089	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card