TkA02G415480 | RubberDandelionOmics

Gene overview

TkA02G415480

Reference: TK1151 Chr: Chr02 Coordinates: 105594753-105598716 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1461 bp · TkA02G415480|TK1151|cDNA

TTAATATTGGTCAAATGTTTCTTCTCACTTCTCTAATCTCCCTCGCACATTCTGACTTAGCTCTTTTAAATCCCCAAAATTTCGCCATCTATGGCCTAATCTCGGCACCAATCATTCGAATATCGCCTCTTCCCTAATATGTAGCATCCGTTTGTTACCTCCTATACTAACAATGGCTTCAGAGAAGGCGAAGGAGCTCGTTTCATCAAACACTGTCGTCGTCTTCAGAATCGTAAGAAATTTAGCGAACTTTTATGGAT...

CDS

Download CDS FASTA

1125 bp · TkA02G415480|TK1151|CDS

ATGGCTTCAGAGAAGGCGAAGGAGCTCGTTTCATCAAACACTGTCGTCGTCTTCAGAATCGTAAGAAATTTAGCGAACTTTTATGGATTTGAAGGATTGATTTGTCAAATCTATTGTCCTTTCTGTGTGGATGTTAAGAAGCTGCTAACGGAGCTTAATGCTTTGTTCAAAGCCATTGAGACTGACCGAGAAATTTTGCAAACTTCATCAATTGTAAGGATTGTCATAAATACAAGGACTATGAACTCCAGCTACAATGT...

Protein

Download Protein FASTA

374 aa · TkA02G415480|TK1151|PROTEIN

MASEKAKELVSSNTVVVFRIVRNLANFYGFEGLICQIYCPFCVDVKKLLTELNALFKAIETDREILQTSSIVRIVINTRTMNSSYNVSTNTLRVMTEQFLFGNRICEEIEIIKALFEPYMFFESYRNYLQVDIVAGDCDDLRAWKGWVGSRLRQLTLMEFYNGDLQHCEITHDKRGRTAQVNIICGDCPNGRCKGGLACVCDVTLESDCRIIVELAIPCEKQGVRVFEGLTLGFRPRSWEIVFPDTGLTVTLSGSGAIGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G415480`
TK1151 ID	TkA02G415480
OH-1004 ID	LXL04_024672
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.300
Protein coverage (%)	TK1151 98.663 / OH-1004 94.541 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G415480

Location Chr02:105594753-105598716 (+)

Description Similar to ELF5: Protein EARLY FLOWERING 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g25850`	Essential protein.	No verified direct reference in this release
`At4g32850`	Essential protein.	No verified direct reference in this release
`At1g17980`	Essential protein.	No verified direct reference in this release
`At5g40370`	Has a glutathione-disulfide oxidoreductase activity in the presence of NADPH and glutathione reductase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024672 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0009908 flower development Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G40370

dosa:Os02g0618100

rcu:8289824

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.484

Rank 1 · TkA02G415480 · TK1151

Nucleus0.372

Rank 2 · TkA02G415480 · TK1151

Mitochondrion0.119

Rank 3 · TkA02G415480 · TK1151

Cell membrane0.117

Rank 4 · TkA02G415480 · TK1151

Extracellular0.066

Rank 5 · TkA02G415480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00462Glutaredoxin4-20 aa

PF00462Glutaredoxin38-62 aa

PF04928PAP_central75-114 aa

PF04926PAP_RNA-bind121-156 aa

PF04926PAP_RNA-bind344-352 aa

PF00462Glutaredoxin351-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G415480	`PF00462`	Glutaredoxin	4	20	0.0042	18.0
TkA02G415480	`PF00462`	Glutaredoxin	38	62	0.0042	18.0
TkA02G415480	`PF04928`	PAP_central	75	114	0.0043	17.5
TkA02G415480	`PF04926`	PAP_RNA-bind	121	156	2.5e-06	28.0
TkA02G415480	`PF04926`	PAP_RNA-bind	344	352	2.5e-06	28.0
TkA02G415480	`PF00462`	Glutaredoxin	351	365	0.0042	18.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82312`	Arabidopsis thaliana	sp\|O82312\|PAPS2_ARATH Nuclear poly(A) polymerase 2	70.400%	Swiss-Prot	Low
`Q8VYW1`	Arabidopsis thaliana	sp\|Q8VYW1\|PAPS4_ARATH Nuclear poly(A) polymerase 4	72.800%	Swiss-Prot	Low
`Q9LMT2`	Arabidopsis thaliana	sp\|Q9LMT2\|PAPS1_ARATH Nuclear poly(A) polymerase 1	59.800%	Swiss-Prot	Low
`Q9FNE2`	Arabidopsis thaliana	sp\|Q9FNE2\|GRXC2_ARATH Glutaredoxin-C2	45.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card