TkA02G380820 | RubberDandelionOmics

Gene overview

TkA02G380820

Reference: TK1151 Chr: Chr02 Coordinates: 96823507-96827593 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2151 bp · TkA02G380820|TK1151|cDNA

ATGGCAGTGGAGGGTGGTAGCAGAAGAGGCCGTGATGACCACCATGAATCCGCCATTCATAGCCGTGGCAAGAAAAAATACCAGCGGCATACTTCTGAGCAGATTCAGCTTCTTGAGGCAACGTTCGATGAATGTCCTCACCCAGATGAAAATTTAAGATCGCAATTGAGTCAGGAGATGGGTTTGACTCCCCGACAGATTAAGTTTTGGTTTCAGAATCGTAGAACTCAATTGAAGGCAAAAAGCGAGACGGCGGATAA...

CDS

Download CDS FASTA

2151 bp · TkA02G380820|TK1151|CDS

ATGGCAGTGGAGGGTGGTAGCAGAAGAGGCCGTGATGACCACCATGAATCCGCCATTCATAGCCGTGGCAAGAAAAAATACCAGCGGCATACTTCTGAGCAGATTCAGCTTCTTGAGGCAACGTTCGATGAATGTCCTCACCCAGATGAAAATTTAAGATCGCAATTGAGTCAGGAGATGGGTTTGACTCCCCGACAGATTAAGTTTTGGTTTCAGAATCGTAGAACTCAATTGAAGGCAAAAAGCGAGACGGCGGATAA...

Protein

Download Protein FASTA

716 aa · TkA02G380820|TK1151|PROTEIN

MAVEGGSRRGRDDHHESAIHSRGKKKYQRHTSEQIQLLEATFDECPHPDENLRSQLSQEMGLTPRQIKFWFQNRRTQLKAKSETADNSLLKMENHKIRSENIAIKEALKNAICSTCGGPHSAQGDCHEEQRLHYENAQLKKELERVSTIVSRYIGRPIMSQFPPDYVEQSHLCSPDLSMVTSLSATQQRMVTMASGGPPPNGIIVSASNTIHPSHPLLLTGMQKSLIADIATSALKELMRLIQTNEPFWTKSADGRDVLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G380820`
TK1151 ID	TkA02G380820
OH-1004 ID	LXL04_014959
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G380820

Location Chr02:96823507-96827593 (+)

Description Similar to HDG11: Homeobox-leucine zipper protein HDG11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g73360`	Transcription factor which acts as a positive regulator of drought stress tolerance.	Characterization of the class IV homeodomain-Leucine Zipper gene family in Arabidopsis.2006 · DOI: 10.1104/pp.106.077388 Cell cycle regulates cell type in the Arabidopsis sepal.2012 · DOI: 10.1242/dev.082925 HDG11 upregulates cell-wall-loosening protein genes to promote root elongation in Arabidopsis.2014 · DOI: 10.1093/jxb/eru202 HD-Zip Proteins GL2 and HDG11 Have Redundant Functions in Arabidopsis Trichomes, and GL2 Activates a Positive Feedback Loop via MYB23.2014 · DOI: 10.1105/tpc.113.120360 Activated expression of AtEDT1/HDG11 promotes lateral root formation in Arabidopsis mutant edt1 by upregulating jasmonate biosynthesis.2015 · DOI: 10.1111/jipb.12347
`At1g17920`	Probable transcription factor that acts as a negative regulator of trichome branching in association with HDG11.	Characterization of the class IV homeodomain-Leucine Zipper gene family in Arabidopsis.2006 · DOI: 10.1104/pp.106.077388 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211
`At4g04890`	Probable transcription factor that binds to the L1 box DNA sequence 5'-TAAATG[CT]A-3'.	Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647
`At4g21750`	Probable transcription factor involved in cell specification and pattern formation during embryogenesis.	Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein.2001 · DOI: 10.1046/j.1365-313x.2001.01047.x Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0208100`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014959 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0009845 seed germination Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010091 trichome branching Biological Process

GO:0030154 cell differentiation Biological Process

GO:0048497 maintenance of floral organ identity Biological Process

GO:0048825 cotyledon development Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

GO:2000033 regulation of seed dormancy process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G17920

ath:AT1G73360

ath:AT4G04890

dosa:Os06g0208100

dosa:Os08g0187500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.879

Rank 1 · TkA02G380820 · TK1151

Cytoplasm0.157

Rank 2 · TkA02G380820 · TK1151

Cell membrane0.047

Rank 3 · TkA02G380820 · TK1151

Plastid0.023

Rank 4 · TkA02G380820 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA02G380820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046Homeodomain24-79 aa

PF05920Homeobox_KN45-76 aa

PF25317SAM_SMF53-78 aa

PF07587PSD188-162 aa

PF25317SAM_SMF177-187 aa

PF25797PDF2_C197-210 aa

PF07587PSD1212-272 aa

PF01852START230-454 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G380820	`PF00046`	Homeodomain	24	79	2.2e-18	66.5
TkA02G380820	`PF05920`	Homeobox_KN	45	76	1.3e-05	25.7
TkA02G380820	`PF25317`	SAM_SMF	53	78	0.67	11.0
TkA02G380820	`PF07587`	PSD1	88	162	0.045	13.9
TkA02G380820	`PF25317`	SAM_SMF	177	187	0.67	11.0
TkA02G380820	`PF25797`	PDF2_C	197	210	3.6e-80	269.2
TkA02G380820	`PF07587`	PSD1	212	272	0.045	13.9
TkA02G380820	`PF01852`	START	230	454	3.1e-35	122.1
TkA02G380820	`PF25797`	PDF2_C	473	708	3.6e-80	269.2
TkA02G380820	`PF01852`	START	635	648	3.1e-35	122.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX31`	Arabidopsis thaliana	sp\|Q9FX31\|HDG11_ARATH Homeobox-leucine zipper protein HDG11	49.900%	Swiss-Prot	Medium
`Q9LMT8`	Arabidopsis thaliana	sp\|Q9LMT8\|HDG12_ARATH Homeobox-leucine zipper protein HDG12	48.400%	Swiss-Prot	Medium
`Q93V99`	Arabidopsis thaliana	sp\|Q93V99\|PDF2_ARATH Homeobox-leucine zipper protein PROTODERMAL FACTOR 2	42.500%	Swiss-Prot	Medium
`Q8RWU4`	Arabidopsis thaliana	sp\|Q8RWU4\|ATML1_ARATH Homeobox-leucine zipper protein MERISTEM L1	40.900%	Swiss-Prot	Medium
`Q69T58`	Oryza sativa subsp. japonica	sp\|Q69T58\|ROC8_ORYSJ Homeobox-leucine zipper protein ROC8	45.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card