TkA02G367060 | RubberDandelionOmics

Gene overview

TkA02G367060

Reference: TK1151 Chr: Chr02 Coordinates: 93353372-93357796 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · TkA02G367060|TK1151|cDNA

ATGTTGTATATAATCGGATTGGGATTGGGCGACGAAAGAGACATTACGCTAAGAGGATTAGAAGCTGTGAAGAAATGCCAAAAGCTCTACATTGAATCCTACACATCTCTCCTTTCCTTTGGTATCTCCAAAGATGGCATCTCCACGCTGGAAAAATTGTATGGAAAGGAACTTACAGTTGCAGATAGGGAAATGGTGGAAGAAAAAGCTGATGACATGTTGTTGGAGGCTCGTGAATTTGATGTTGCTTTCCTTGTTGT...

CDS

Download CDS FASTA

1149 bp · TkA02G367060|TK1151|CDS

ATGTTGTATATAATCGGATTGGGATTGGGCGACGAAAGAGACATTACGCTAAGAGGATTAGAAGCTGTGAAGAAATGCCAAAAGCTCTACATTGAATCCTACACATCTCTCCTTTCCTTTGGTATCTCCAAAGATGGCATCTCCACGCTGGAAAAATTGTATGGAAAGGAACTTACAGTTGCAGATAGGGAAATGGTGGAAGAAAAAGCTGATGACATGTTGTTGGAGGCTCGTGAATTTGATGTTGCTTTCCTTGTTGT...

Protein

Download Protein FASTA

382 aa · TkA02G367060|TK1151|PROTEIN

MLYIIGLGLGDERDITLRGLEAVKKCQKLYIESYTSLLSFGISKDGISTLEKLYGKELTVADREMVEEKADDMLLEAREFDVAFLVVGDPFGATTHSDLVVRAKKLEVEVKVIYNASVMNAVGVCGLQLYRYGETVSLPFFTDTWRPDSFYEKIQRNRGLGLHTLCLLDIRVKEPSLESLCRGKKQYEPPSFMTIGVAIDQLLEVEQLRGESAYNEDTLCVGFARLGSESQMVVAGSMKQLRTVDFGQPLHCLTIVGKTH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G367060`
TK1151 ID	TkA02G367060
OH-1004 ID	LXL04_015116
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	88.600
Protein coverage (%)	TK1151 100.000 / OH-1004 99.465 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G367060

Location Chr02:93353372-93357796 (-)

Description Similar to At4g31790: Probable diphthine methyl ester synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31790`	S-adenosyl-L-methionine-dependent methyltransferase that catalyzes four methylations of the modified target histidine residue in translation elongation factor 2 (EF-2), to form an intermediate called diphthine methyl ester.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015116 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0017183 protein histidyl modification to diphthamide Biological Process

GO:0032259 methylation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016740 transferase activity Molecular Function

GO:0141133 diphthine methyl ester synthase activity Molecular Function

KEGG gene cross-reference

ath:AT4G31790

bta:508904

ddi:DDB_G0276115

hsa:51611

mmu:69740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.589

Rank 1 · TkA02G367060 · TK1151

Nucleus0.344

Rank 2 · TkA02G367060 · TK1151

Mitochondrion0.152

Rank 3 · TkA02G367060 · TK1151

Peroxisome0.091

Rank 4 · TkA02G367060 · TK1151

Endoplasmic reticulum0.049

Rank 5 · TkA02G367060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00590TP_methylase1-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G367060	`PF00590`	TP_methylase	1	241	7e-20	72.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81769`	Arabidopsis thaliana	sp\|O81769\|DPH5_ARATH Probable diphthine methyl ester synthase	77.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card