RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G334430
Reference: TK1151 Chr: Chr02 Coordinates: 84863358-84867716 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2099 bp · TkA02G334430|TK1151|cDNA

CAAAATGTGAAATTCTATCACTCCAGAGTCCAATCATCCAAATTCATCTTCATAATCAAATCGACCGCTCCTACTTTTTCACTTCTTCAGGGGTTCGATTCTGAGTTGAGTTACATCGATCACCCATTAATCATGTCTCTGAGGCCAAACGCTAGGACTGAGGTTCGCCGGAACCGGTACAAGGTAGCCGTAGATGCGGAGGAAGGAAGGCGGAGGAGGGAGGACAATATGGTTGAGATCCGTAAAAACAAGAGAGAGGA...

CDS

Download CDS FASTA

1737 bp · TkA02G334430|TK1151|CDS

CAAAATGTGAAATTCTATCACTCCAGAGTCCAATCATCCAAATTCATCTTCATAATCAAATCGACCGCTCCTACTTTTTCACTTCTTCAGGGGTTCGATTCTGAGTTGAGTTACATCGATCACCCATTAATCATGTCTCTGAGGCCAAACGCTAGGACTGAGGTTCGCCGGAACCGGTACAAGGTAGCCGTAGATGCGGAGGAAGGAAGGCGGAGGAGGGAGGACAATATGGTTGAGATCCGTAAAAACAAGAGAGAGGA...

Protein

Download Protein FASTA

578 aa · TkA02G334430|TK1151|PROTEIN

QNVKFYHSRVQSSKFIFIIKSTAPTFSLLQGFDSELSYIDHPLIMSLRPNARTEVRRNRYKVAVDAEEGRRRREDNMVEIRKNKREENLLKKRQVVPSSQPLSTGAPIQTATTEKKLESLPSMVAGVYSNDNNMQLEATTQFRKLLSIERSPPIEEVIQSGVVPRFVEFLMREDFPQLQFEAAWALTNIASGTSENTKVVIDHGAVPIFVKLLASPSDDVREQAVWALGNIAGDSPKCRDLVLGQGALVPLLAQLNEHAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G334430
TK1151 IDTkA02G334430
OH-1004 IDLXL04_015427
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 94.810 / OH-1004 85.893
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G334430
LocationChr02:84863358-84867716 (-)
DescriptionSimilar to IMPA2: Importin subunit alpha-2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g06720 Binds to conventional NLS motifs with high affinity in the absence of an importin beta subunit.
SWO1 modulates cell wall integrity under salt stress by interacting with importin ɑ in Arabidopsis.2021 · DOI: 10.1007/s44154-021-00010-5
At4g16143 Binds to conventional NLS motifs and mediates nuclear protein import across the nuclear envelope.
SWO1 modulates cell wall integrity under salt stress by interacting with importin ɑ in Arabidopsis.2021 · DOI: 10.1007/s44154-021-00010-5
At4g02150 Binds to conventional NLS motifs and mediates nuclear protein import across the nuclear envelope (By similarity).
An importin alpha homolog, MOS6, plays an important role in plant innate immunity.2005 · DOI: 10.1016/j.cub.2005.05.022

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0253300 Functions in nuclear protein import. No verified direct reference in this release
Os05g0155601 Functions in nuclear protein import. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_015427 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006606 protein import into nucleus Biological Process
GO:0006607 NLS-bearing protein import into nucleus Biological Process
GO:0009651 response to salt stress Biological Process
GO:0071555 cell wall organization Biological Process
GO:2000280 regulation of root development Biological Process
GO:0005634 nucleus Cellular Component
GO:0005635 nuclear envelope Cellular Component
GO:0005730 nucleolus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009506 plasmodesma Cellular Component
KEGG gene cross-reference
ath:AT3G06720
ath:AT4G16143
sly:543535
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.562
Rank 1 · TkA02G334430 · TK1151
Cytoplasm0.533
Rank 2 · TkA02G334430 · TK1151
Mitochondrion0.065
Rank 3 · TkA02G334430 · TK1151
Cell membrane0.058
Rank 4 · TkA02G334430 · TK1151
Endoplasmic reticulum0.041
Rank 5 · TkA02G334430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01749IBB56-140 aa
PF23227HEAT_MROH2B_C114-159 aa
PF25579TPR_TRIP12_N115-236 aa
PF00514Arm151-191 aa
PF25598ARM_PUB152-249 aa
PF24768ARM_ARMC5154-276 aa
PF30701ARMC6156-249 aa
PF16201NopRA1158-195 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G334430PF01749IBB561408.2e-2691.1
TkA02G334430PF23227HEAT_MROH2B_C1141591.4e-0525.3
TkA02G334430PF25579TPR_TRIP12_N1152364.7e-0834.0
TkA02G334430PF00514Arm1511919.5e-95308.7
TkA02G334430PF25598ARM_PUB1522496.4e-0729.8
TkA02G334430PF24768ARM_ARMC51542761.4e-1971.3
TkA02G334430PF30701ARMC61562497.2e-0832.1
TkA02G334430PF16201NopRA11581955.1e-0626.9
TkA02G334430PF14668RICTOR_V1591910.06814.1
TkA02G334430PF02985HEAT1631915e-1658.0
TkA02G334430PF13646HEAT_21642347e-2071.8
TkA02G334430PF22964ZER1-like_2nd1662191.5e-0731.1
TkA02G334430PF23271HEAT_GCN11712351e-0526.4
TkA02G334430PF30746TMCO61725203.5e-1453.1
TkA02G334430PF13513HEAT_EZ1762311.2e-2796.5
TkA02G334430PF04826Arm_21762333.5e-0730.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q96321Arabidopsis thalianasp|Q96321|IMPA1_ARATH Importin subunit alpha-179.500%Swiss-ProtHigh
F4JL11Arabidopsis thalianasp|F4JL11|IMPA2_ARATH Importin subunit alpha-271.200%Swiss-ProtHigh
O04294Arabidopsis thalianasp|O04294|IMPA3_ARATH Importin subunit alpha-373.900%Swiss-ProtHigh
Q71VM4Oryza sativa subsp. japonicasp|Q71VM4|IMA1A_ORYSJ Importin subunit alpha-1a77.300%Swiss-ProtHigh
Q9SLX0Oryza sativa subsp. japonicasp|Q9SLX0|IMA1B_ORYSJ Importin subunit alpha-1b69.000%Swiss-ProtHigh

JBrowse

View in Genome Browser