TkA02G297090 | RubberDandelionOmics

Gene overview

TkA02G297090

Reference: TK1151 Chr: Chr02 Coordinates: 75723430-75724759 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

761 bp · TkA02G297090|TK1151|cDNA

GTATAATGTAAGATGTCATATGTCATATGATCACAAGTGTTCAAGAAGAGACTCTTTTGTTATAGGCAGCGGACACGCGTCTCTCAGTATCCAACTCACAAACATAATATATCTAAAGATTATTTATCAAAGAAGATGAGAAGAAACACAATCATTTCTTGGAAGATGGCAGCAGAGGGAGCTTCATTCCACCATGTCGCCAGAGAAACCTCAGATGTCGATCGACTTGCTATGTTTTACCAAGAGATACTTGGACTTGA...

CDS

Download CDS FASTA

444 bp · TkA02G297090|TK1151|CDS

ATGAGAAGAAACACAATCATTTCTTGGAAGATGGCAGCAGAGGGAGCTTCATTCCACCATGTCGCCAGAGAAACCTCAGATGTCGATCGACTTGCTATGTTTTACCAAGAGATACTTGGACTTGAACGGATACAAAACCCTAAATTCGACTTCAAGGTAATCTGGCTAAAGCAATCGCCATCTTTCTATCTCCACCTAATTGAAACGGATCCAAACGCGAAGCTGCCAGAAGGTCCATGGAGTGCTGAAGGTGCTGTCGC...

Protein

Download Protein FASTA

147 aa · TkA02G297090|TK1151|PROTEIN

MRRNTIISWKMAAEGASFHHVARETSDVDRLAMFYQEILGLERIQNPKFDFKVIWLKQSPSFYLHLIETDPNAKLPEGPWSAEGAVADPKNLSRGHHLCFSVSNYDAVVKTLKDKGIETHEKTRPDGKTKQVFFFDPDGNGLEVASQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G297090`
TK1151 ID	TkA02G297090
OH-1004 ID	LXL04_015707
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G297090`
Location	Chr02:75723430-75724759 (-)
Description	Similar to glo1: Lactoylglutathione lyase (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015707` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0071470 cellular response to osmotic stress Biological Process GO:1990748 cellular detoxification Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0004462 lactoylglutathione lyase activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	bsu:BSU37020 spo:2539736 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.662

Rank 1 · TkA02G297090 · TK1151

Nucleus0.321

Rank 2 · TkA02G297090 · TK1151

Peroxisome0.093

Rank 3 · TkA02G297090 · TK1151

Endoplasmic reticulum0.080

Rank 4 · TkA02G297090 · TK1151

Mitochondrion0.076

Rank 5 · TkA02G297090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13468Glyoxalase_314-36 aa

PF00903Glyoxalase18-144 aa

PF13669Glyoxalase_419-129 aa

PF13468Glyoxalase_319-129 aa

PF22658YycE-like_N20-45 aa

PF18029Glyoxalase_622-144 aa

PF22677Ble-like_N25-44 aa

PF12681Glyoxalase_226-42 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G297090	`PF13468`	Glyoxalase_3	14	36	9e-06	26.5
TkA02G297090	`PF00903`	Glyoxalase	18	144	1.1e-11	45.9
TkA02G297090	`PF13669`	Glyoxalase_4	19	129	8.4e-10	39.6
TkA02G297090	`PF13468`	Glyoxalase_3	19	129	9e-06	26.5
TkA02G297090	`PF22658`	YycE-like_N	20	45	0.0025	18.4
TkA02G297090	`PF18029`	Glyoxalase_6	22	144	7.6e-06	27.3
TkA02G297090	`PF22677`	Ble-like_N	25	44	0.21	12.1
TkA02G297090	`PF12681`	Glyoxalase_2	26	42	0.00095	19.8
TkA02G297090	`PF12681`	Glyoxalase_2	92	146	0.00095	19.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card