LXL04_015707 | RubberDandelionOmics

Gene overview

LXL04_015707

Reference: OH-1004 Chr: Chr03 Coordinates: 81129214-81130346 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

444 bp · LXL04_015707|LXL04_015707|OH1004|cDNA

ATGAGAAGAAACACAATCATTTCTTGGAAGATGGCAGCAGAGGGAGCTTCATTCCACCATGTCGCCAGAGAAACCTCAGATGTCGATCGACTTGCTAAGTTTTACCAAGAGATACTTGGACTTGAACGGATACAAAACCCTAAATTCGACTTCAAGGTAATCTGGCTAAAGCAATCGCCATCTTTCTATCTCCACCTAATTGAAAGGGATCCAAACGCGAAGCTGCCAGAAGGTCCATGGAGTGCTGAAGGTGCTGTCGC...

CDS

Download CDS FASTA

444 bp · LXL04_015707|LXL04_015707|OH1004|CDS

ATGAGAAGAAACACAATCATTTCTTGGAAGATGGCAGCAGAGGGAGCTTCATTCCACCATGTCGCCAGAGAAACCTCAGATGTCGATCGACTTGCTAAGTTTTACCAAGAGATACTTGGACTTGAACGGATACAAAACCCTAAATTCGACTTCAAGGTAATCTGGCTAAAGCAATCGCCATCTTTCTATCTCCACCTAATTGAAAGGGATCCAAACGCGAAGCTGCCAGAAGGTCCATGGAGTGCTGAAGGTGCTGTCGC...

Protein

Download Protein FASTA

147 aa · LXL04_015707|LXL04_015707|OH1004|PROTEIN

MRRNTIISWKMAAEGASFHHVARETSDVDRLAKFYQEILGLERIQNPKFDFKVIWLKQSPSFYLHLIERDPNAKLPEGPWSAEGAVADPKNLSRGHHLCFSVSNYDAVVKTLKDKGIETHEKTRPDGKTKQVFFFDPDGNGLEVASQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015707`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_015707`
Location	Chr03:81129214-81130346 (+)
Description	Similar to glo1: Lactoylglutathione lyase (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015707` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0071470 cellular response to osmotic stress Biological Process GO:1990748 cellular detoxification Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0004462 lactoylglutathione lyase activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	bsu:BSU37020 spo:2539736 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.644

Rank 1 · LXL04_015707 · OH-1004

Nucleus0.296

Rank 2 · LXL04_015707 · OH-1004

Peroxisome0.106

Rank 3 · LXL04_015707 · OH-1004

Endoplasmic reticulum0.088

Rank 4 · LXL04_015707 · OH-1004

Mitochondrion0.084

Rank 5 · LXL04_015707 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00903.32Glyoxalase18-144 aa

PF13468.13Glyoxalase_318-129 aa

PF13669.13Glyoxalase_419-129 aa

PF18029.8Glyoxalase_622-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015707	`PF00903.32`	Glyoxalase	18	144	1.1e-12	49.1
LXL04_015707	`PF13468.13`	Glyoxalase_3	18	129	5.3e-06	27.3
LXL04_015707	`PF13669.13`	Glyoxalase_4	19	129	2.3e-10	41.5
LXL04_015707	`PF18029.8`	Glyoxalase_6	22	144	2.2e-06	29.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card