TkA02G282400 | RubberDandelionOmics

Gene overview

TkA02G282400

Reference: TK1151 Chr: Chr02 Coordinates: 72039838-72041522 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1233 bp · TkA02G282400|TK1151|cDNA

TTGCTACCAAATATAGAGAGTACTACCAAGCATTGTTTTCTTCTTAGTGTACTCACAAGATCTGAATTTAAACAATCCTATCCTGATTATGTACGCTTCCAACTTGATCCATTTCTGAATGAACTAACTAGCATGTTCGAGCACACTATCGAAAAAGGCTCCGTGTGGGTTGCTCTTAAACACTCTTCTGACAAATCTAAGGTGCAGAGAGATAAAATGACAACTGCTGGTGAAGAACTTGAGTACAAATGTCTTGTTAG...

CDS

Download CDS FASTA

387 bp · TkA02G282400|TK1151|CDS

TTGCTACCAAATATAGAGAGTACTACCAAGCATTGTTTTCTTCTTAGTGTACTCACAAGATCTGAATTTAAACAATCCTATCCTGATTATGTACGCTTCCAACTTGATCCATTTCTGAATGAACTAACTAGCATGTTCGAGCACACTATCGAAAAAGGCTCCGTGTGGGTTGCTCTTAAACACTCTTCTGACAAATCTAAGGTGCAGAGAGATAAAATGACAACTGCTGGTGAAGAACTTGAGTACAAATGTCTTGTTAG...

Protein

Download Protein FASTA

128 aa · TkA02G282400|TK1151|PROTEIN

LLPNIESTTKHCFLLSVLTRSEFKQSYPDYVRFQLDPFLNELTSMFEHTIEKGSVWVALKHSSDKSKVQRDKMTTAGEELEYKCLVRATDGKKNISTLVGMKEHQRFQAYYVIILKARMTSLKKREKR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G282400`
TK1151 ID	TkA02G282400
OH-1004 ID	LXL04_030602
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.700
Protein coverage (%)	TK1151 76.562 / OH-1004 81.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G282400

Location Chr02:72039838-72041522 (+)

Description Similar to SRP14: Signal recognition particle 14 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43640`	Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER) (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0623700`	Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER) (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030602 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006613 cotranslational protein targeting to membrane Biological Process

GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process

GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition Biological Process

GO:0045047 protein targeting to ER Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034774 secretory granule lumen Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008312 7S RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43640

dosa:Os04g0623700

hsa:6727

mcf:101864926

pon:100172315

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.470

Rank 1 · TkA02G282400 · TK1151

Nucleus0.428

Rank 2 · TkA02G282400 · TK1151

Mitochondrion0.100

Rank 3 · TkA02G282400 · TK1151

Cell membrane0.044

Rank 4 · TkA02G282400 · TK1151

Endoplasmic reticulum0.044

Rank 5 · TkA02G282400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02290SRP1436-122 aa

PF04398DUF53846-108 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G282400	`PF02290`	SRP14	36	122	1.8e-21	77.2
TkA02G282400	`PF04398`	DUF538	46	108	0.058	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04421`	Arabidopsis thaliana	sp\|O04421\|SRP14_ARATH Signal recognition particle 14 kDa protein	69.400%	Swiss-Prot	High
`O04433`	Oryza sativa subsp. japonica	sp\|O04433\|SRP14_ORYSJ Signal recognition particle 14 kDa protein	58.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card