Gene Card
Gene overview
cDNA / CDS / Protein Sequences
363 bp · LXL04_030602|LXL04_030602|OH1004|cDNA
ATGGTGCGTTTACAGCTTGATCCATTTCTCAGTGAACTAACTAACATGTTTGAGCACACTACAGAAAAAGGATCTGTGTGGGTTACTCTCAAACACTCTTCTGACAAGTCTAAGGTACAGAGAGATAAGATGGAAAGTTCTGGTAAAGAAGTTGAGTTCAAGTGTCTTATTAGAGCAACTGATGGCAAAAAGAACATTTCCACATtgGTTGGAATGAAGGACCATCAACGGTTTCAAGCATCTTATGCTACAATCTTGAA...
363 bp · LXL04_030602|LXL04_030602|OH1004|CDS
ATGGTGCGTTTACAGCTTGATCCATTTCTCAGTGAACTAACTAACATGTTTGAGCACACTACAGAAAAAGGATCTGTGTGGGTTACTCTCAAACACTCTTCTGACAAGTCTAAGGTACAGAGAGATAAGATGGAAAGTTCTGGTAAAGAAGTTGAGTTCAAGTGTCTTATTAGAGCAACTGATGGCAAAAAGAACATTTCCACATTGGTTGGAATGAAGGACCATCAACGGTTTCAAGCATCTTATGCTACAATCTTGAA...
Protein
Download Protein FASTA120 aa · LXL04_030602|LXL04_030602|OH1004|PROTEIN
MVRLQLDPFLSELTNMFEHTTEKGSVWVTLKHSSDKSKVQRDKMESSGKEVEFKCLIRATDGKKNISTLVGMKDHQRFQASYATILKARMTSLKKREKKDKRKASDVDKKQQVSKKSAKT
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_030602 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_030602 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:119440794-119441682 (-) | ||||||||||||
| Description | Similar to SRP14: Signal recognition particle 14 kDa protein | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006613 cotranslational protein targeting to membrane Biological Process GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition Biological Process GO:0045047 protein targeting to ER Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component GO:0005829 cytosol Cellular Component GO:0034774 secretory granule lumen Cellular Component GO:0003723 RNA binding Molecular Function GO:0008312 7S RNA binding Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT2G43640 dosa:Os04g0623700 hsa:6727 mcf:101864926 pon:100172315 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02290.21SRP144-93 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_030602 | PF02290.21 | SRP14 | 4 | 93 | 8.3e-25 | 87.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.