TkA02G207470 | RubberDandelionOmics

Gene overview

TkA02G207470

Reference: TK1151 Chr: Chr02 Coordinates: 52972967-52975871 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1002 bp · TkA02G207470|TK1151|cDNA

ATGAACAAGTCTTTTATTTCCTCTAACCCTAAGCGAGCCTTCCTTTTTCCACCTCCATTCTCCATGGCGGCAGCCCTTCTTCCAGCTCTTTTCCGGAAATTTCCTCCCCTCTCTCGACTATTAAATTACGCTACCAGCCTCCTCCGTCCTTGCGTTGGCTGCTGCTCCATCCGGCAGCTCCTGTTCGAGTGTAGTTCATATCGTCAGCAAGGAGAAAGCACTCCACCGGCGAGTAAAAGCAAAACAGCCCCCGGTCGGGT...

CDS

Download CDS FASTA

1002 bp · TkA02G207470|TK1151|CDS

ATGAACAAGTCTTTTATTTCCTCTAACCCTAAGCGAGCCTTCCTTTTTCCACCTCCATTCTCCATGGCGGCAGCCCTTCTTCCAGCTCTTTTCCGGAAATTTCCTCCCCTCTCTCGACTATTAAATTACGCTACCAGCCTCCTCCGTCCTTGCGTTGGCTGCTGCTCCATCCGGCAGCTCCTGTTCGAGTGTAGTTCATATCGTCAGCAAGGAGAAAGCACTCCACCGGCGAGTAAAAGCAAAACAGCCCCCGGTCGGGT...

Protein

Download Protein FASTA

333 aa · TkA02G207470|TK1151|PROTEIN

MNKSFISSNPKRAFLFPPPFSMAAALLPALFRKFPPLSRLLNYATSLLRPCVGCCSIRQLLFECSSYRQQGESTPPASKSKTAPGRVSWSFDHQGLESLFFSAISLHLQVHGLSLVDGNGTRPGESRRAVYFSKLIEAEAFSQVKDKEVVSFIKQNILTRFGISAEIICDNGSQFISKRTTDFCTAWGIKMITSTPIHPQANGQAKSKELPFVLWADRTTAKTATGQTPYALDPQTNNRILAEDLDTIDELRDLAKIRIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G207470`
TK1151 ID	TkA02G207470
OH-1004 ID	LXL04_025061
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	73.200
Protein coverage (%)	TK1151 60.961 / OH-1004 44.007 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G207470`
Location	Chr02:52972967-52975871 (+)
Description	Similar to pol: Gag-Pol polyprotein (Fragment)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025061` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0019068 virion assembly Biological Process GO:0039657 symbiont-mediated suppression of host gene expression Biological Process GO:0044826 viral genome integration into host DNA Biological Process GO:0046718 symbiont entry into host cell Biological Process GO:0075713 establishment of integrated proviral latency Biological Process GO:0005634 nucleus Cellular Component GO:0019013 viral nucleocapsid Cellular Component GO:0020002 host cell plasma membrane Cellular Component GO:0044185 host cell late endosome membrane Cellular Component
KEGG gene cross-reference	bta:504972 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.386

Rank 1 · TkA02G207470 · TK1151

Nucleus0.217

Rank 2 · TkA02G207470 · TK1151

Mitochondrion0.162

Rank 3 · TkA02G207470 · TK1151

Plastid0.157

Rank 4 · TkA02G207470 · TK1151

Peroxisome0.064

Rank 5 · TkA02G207470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00665rve132-199 aa

PF29688TnsB_C160-203 aa

PF31073DUF8803279-332 aa

PF24626SH3_Tf2-1282-322 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G207470	`PF00665`	rve	132	199	6.6e-09	36.7
TkA02G207470	`PF29688`	TnsB_C	160	203	0.00054	20.5
TkA02G207470	`PF31073`	DUF8803	279	332	1.4e-18	67.2
TkA02G207470	`PF24626`	SH3_Tf2-1	282	322	0.0022	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card