LXL04_025061 | RubberDandelionOmics

Gene overview

LXL04_025061

Reference: OH-1004 Chr: Chr05 Coordinates: 105000068-105002050 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1680 bp · LXL04_025061|LXL04_025061|OH1004|cDNA

atgagaaaacccgaaatgtctgggagaatggcaaaatggtcagtaaaacttagcacatataacataatatacgagccgaaaacagcgataaagtcgcaagctctagcagactttgtggctgatttcagcagtgatctcaaaaaagaagtagaaatagaggtagaacaactccataaggagaacgtaggaaaatggattctctttacagatggagcttcaaacgccaaaggaactggactggggatcatgctaaaatcgcc...

CDS

Download CDS FASTA

1680 bp · LXL04_025061|LXL04_025061|OH1004|CDS

ATGAGAAAACCCGAAATGTCTGGGAGAATGGCAAAATGGTCAGTAAAACTTAGCACATATAACATAATATACGAGCCGAAAACAGCGATAAAGTCGCAAGCTCTAGCAGACTTTGTGGCTGATTTCAGCAGTGATCTCAAAAAAGAAGTAGAAATAGAGGTAGAACAACTCCATAAGGAGAACGTAGGAAAATGGATTCTCTTTACAGATGGAGCTTCAAACGCCAAAGGAACTGGACTGGGGATCATGCTAAAATCGCC...

Protein

Download Protein FASTA

559 aa · LXL04_025061|LXL04_025061|OH1004|PROTEIN

MRKPEMSGRMAKWSVKLSTYNIIYEPKTAIKSQALADFVADFSSDLKKEVEIEVEQLHKENVGKWILFTDGASNAKGTGLGIMLKSPQGDIIPQAVRCEFNATNNEAEYEALIMGLQLAQDLQIKDIQVYVDSLLITNHYNGSYAVKGEKLVLYLEVLRQIAATFEFFKINQVPREENTEADALANLGSALRIPPDTVIPIVHLMIPAIEDPNRQSDLTTQDPKNQVSAIMDPSTSNPNAQDPDNTQGSWTKPIKEYILN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025061`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_025061`
Location	Chr05:105000068-105002050 (+)
Description	Similar to pol: Gag-Pol polyprotein (Fragment)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025061` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0019068 virion assembly Biological Process GO:0039657 symbiont-mediated suppression of host gene expression Biological Process GO:0044826 viral genome integration into host DNA Biological Process GO:0046718 symbiont entry into host cell Biological Process GO:0075713 establishment of integrated proviral latency Biological Process GO:0005634 nucleus Cellular Component GO:0019013 viral nucleocapsid Cellular Component GO:0020002 host cell plasma membrane Cellular Component GO:0044185 host cell late endosome membrane Cellular Component
KEGG gene cross-reference	bta:504972 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.671

Rank 1 · LXL04_025061 · OH-1004

Nucleus0.241

Rank 2 · LXL04_025061 · OH-1004

Mitochondrion0.117

Rank 3 · LXL04_025061 · OH-1004

Peroxisome0.048

Rank 4 · LXL04_025061 · OH-1004

Cell membrane0.044

Rank 5 · LXL04_025061 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00075.31RNase_H65-138 aa

PF13456.13RVT_370-187 aa

PF00665.33rve290-371 aa

PF29688.1TnsB_C333-392 aa

PF31073.1DUF8803494-558 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025061	`PF00075.31`	RNase_H	65	138	3e-07	31.4
LXL04_025061	`PF13456.13`	RVT_3	70	187	1.9e-18	67.3
LXL04_025061	`PF00665.33`	rve	290	371	3.9e-14	53.5
LXL04_025061	`PF29688.1`	TnsB_C	333	392	1.3e-07	32.2
LXL04_025061	`PF31073.1`	DUF8803	494	558	6e-27	94.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card