TkA02G192610 | RubberDandelionOmics

Gene overview

TkA02G192610

Reference: TK1151 Chr: Chr02 Coordinates: 49377070-49379500 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1850 bp · TkA02G192610|TK1151|cDNA

TGACTTTTGACTATGGCGTCACAAAATTAAAAGCGTTATTTTGATACAGAGCGCGCTCTCTCTCTCCGTCTGTCTGTCTCCCTCTCTCTCTCGTGGTTGTTGATCTGTATTCATTATTGAAGGTTGGAAAAAGTTGTCATTTTGGACGTTAGCTGTAACTCCAATTGCTTCTAGCGATCCCCTCACTGTGATCACGCCCTTCTCTTTATATACTTTTACACCAAACGGTTTGATTTTTGAATTTAGCTCTGTTAAATGGG...

CDS

Download CDS FASTA

1398 bp · TkA02G192610|TK1151|CDS

ATGGGTGCTTGTTATTCAACAACAGGCGGCGCCCGGAGAGATAAACACGATAAAGGTGATGAAGATGAAGGATGGTGGAAGTCCAAGCGTGGTAGTGAGATCAATCGTACATCCACCTTCGTGCTCGGCGGCAGTGTGGAGGAGCGACTGCTCCACAATATTCCTGGTAGGCTTTTCGGTAATGGCTCCTGCAATATCGCTAGTTTACATACGCAACAAGGCAAGAAAGGGACCAATCAAGACGCCATGATCGTTTGGGA...

Protein

Download Protein FASTA

465 aa · TkA02G192610|TK1151|PROTEIN

MGACYSTTGGARRDKHDKGDEDEGWWKSKRGSEINRTSTFVLGGSVEERLLHNIPGRLFGNGSCNIASLHTQQGKKGTNQDAMIVWEKFNSSSDATFCGVFDGHGPYGHMVAKKVRDSLPVLLSTKWMDTTNTHHISDNSNTNESIPEEELFEEYWCEQSDDEEKETIPEKYSPLKKCLLKSFKLIDKELKNHPSIDCFCSGSTAVSLIKQGQDLVIGNLGDSRAVLGTRDEHNSLVPVQLTVDLKPNLPREAARIQQFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G192610`
TK1151 ID	TkA02G192610
OH-1004 ID	LXL04_016102
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G192610

Location Chr02:49377070-49379500 (+)

Description Similar to At1g16220: Probable protein phosphatase 2C 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16220`	Probable protein phosphatase 2C 6.	No verified direct reference in this release
`At1g79630`	Probable protein phosphatase 2C 18.	No verified direct reference in this release
`At3g02750`	Probable protein phosphatase 2C 33.	No verified direct reference in this release
`At1g03590`	May act as negative regulator of GCN5.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0500300`	Probable protein phosphatase 2C 66.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016102 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G16220

ath:AT1G79630

ath:AT3G02750

dosa:Os08g0500300

dosa:Os11g0417400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405

Rank 1 · TkA02G192610 · TK1151

Nucleus0.354

Rank 2 · TkA02G192610 · TK1151

Cell membrane0.214

Rank 3 · TkA02G192610 · TK1151

Endoplasmic reticulum0.085

Rank 4 · TkA02G192610 · TK1151

Golgi apparatus0.080

Rank 5 · TkA02G192610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C72-357 aa

PF13672PP2C_2164-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G192610	`PF00481`	PP2C	72	357	4.2e-42	145.3
TkA02G192610	`PF13672`	PP2C_2	164	336	0.096	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA22`	Arabidopsis thaliana	sp\|Q9SA22\|P2C06_ARATH Probable protein phosphatase 2C 6	59.100%	Swiss-Prot	High
`Q8RXZ4`	Arabidopsis thaliana	sp\|Q8RXZ4\|P2C18_ARATH Probable protein phosphatase 2C 18	57.100%	Swiss-Prot	High
`Q9M8R7`	Arabidopsis thaliana	sp\|Q9M8R7\|P2C33_ARATH Probable protein phosphatase 2C 33	53.200%	Swiss-Prot	High
`Q9LR65`	Arabidopsis thaliana	sp\|Q9LR65\|P2C01_ARATH Probable protein phosphatase 2C 1	50.700%	Swiss-Prot	High
`Q6ZKL8`	Oryza sativa subsp. japonica	sp\|Q6ZKL8\|P2C66_ORYSJ Probable protein phosphatase 2C 66	59.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card