TkA02G182470 | RubberDandelionOmics

Gene overview

TkA02G182470

Reference: TK1151 Chr: Chr02 Coordinates: 46899327-46902067 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1788 bp · TkA02G182470|TK1151|cDNA

ATGTGCAGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAAGTTCCTTAAAGGAATTACAGAACACCATCGATCTTGCAGAAGCTCTGAACGTGAGCAGTTTGACCAAGCTGACCGAGAAGCCGATGAATGGAGGGCTAGGGAAATTGCAAATGAGGTCGCTAAGCAAAGGGT...

CDS

Download CDS FASTA

834 bp · TkA02G182470|TK1151|CDS

ATGTGCAGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAAGTTCCTTAAAGGAATTACAGAACACCATCGATCTTGCAGAAGCTCTGAACGTGAGCAGTTTGACCAAGCTGACCGAGAAGCCGATGAATGGAGGGCTAGGGAAATTGCAAATGAGGTCGCTAAGCAAAGGGT...

Protein

Download Protein FASTA

277 aa · TkA02G182470|TK1151|PROTEIN

MCSHSLYEYDDAPNESTSTCTCTVGPTIAPNDKWLLERYKCSKFLKGITEHHRSCRSSEREQFDQADREADEWRAREIANEVAKQRVEKMKEIAKQKAKEERKRLESELELVLIVEKLQELRSIRIQKLTKQGHFLPEEDNKFLERIRVAVEEEERQLMAAADTSAAKDAITSALNSEDQITVKDDKDNQVIKEKTNEKEVVDVDNHGKGSYDYSSNLPLKFYHYYHESSTDMGTLIEVRRTWDAYIRPGGSRIPGHWVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G182470`
TK1151 ID	TkA02G182470
OH-1004 ID	LXL04_023816
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	65.800
Protein coverage (%)	TK1151 99.278 / OH-1004 94.602 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G182470

Location Chr02:46899327-46902067 (+)

Description Similar to SNRNP59: U11/U12 small nuclear ribonucleoprotein 59 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46200`	U11/U12 small nuclear ribonucleoprotein 59 kDa protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023816 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G46200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.717

Rank 1 · TkA02G182470 · TK1151

Cytoplasm0.289

Rank 2 · TkA02G182470 · TK1151

Cell membrane0.051

Rank 3 · TkA02G182470 · TK1151

Mitochondrion0.033

Rank 4 · TkA02G182470 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA02G182470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412ArfGap40-104 aa

PF16524RisS_PPD53-95 aa

PF16021PDCD754-273 aa

PF16524RisS_PPD113-154 aa

PF01412ArfGap152-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G182470	`PF01412`	ArfGap	40	104	2.2	9.1
TkA02G182470	`PF16524`	RisS_PPD	53	95	1.3	10.2
TkA02G182470	`PF16021`	PDCD7	54	273	1.4e-20	74.5
TkA02G182470	`PF16524`	RisS_PPD	113	154	1.3	10.2
TkA02G182470	`PF01412`	ArfGap	152	200	2.2	9.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYD3`	Arabidopsis thaliana	sp\|Q8VYD3\|U1159_ARATH U11/U12 small nuclear ribonucleoprotein 59 kDa protein	43.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card