TkA02G172170 | RubberDandelionOmics

Gene overview

TkA02G172170

Reference: TK1151 Chr: Chr02 Coordinates: 44222178-44225689 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1917 bp · TkA02G172170|TK1151|cDNA

CGAAGATCTACTAAAAAGGAAACCGTATTAACTATCAGTCTATCGCTACCCTTATATCCTATCCATTCGGTTGCCTATTGCTGCTATCTTTAACAAAGCTTTAAACAACTACACAGCAATGGAGCTATGCAGTTCGGCTCCTCCAACGTTATCCTATTTGAAATCCTGTGTTGTTTCCCCTCCAATTTCTTCGATTTCTTTCTGCAATTCCTTCAGACCTACGAATCGATTCACTTCTCTTAAAATATCTCGTTCTGGTC...

CDS

Download CDS FASTA

1599 bp · TkA02G172170|TK1151|CDS

ATGGAGCTATGCAGTTCGGCTCCTCCAACGTTATCCTATTTGAAATCCTGTGTTGTTTCCCCTCCAATTTCTTCGATTTCTTTCTGCAATTCCTTCAGACCTACGAATCGATTCACTTCTCTTAAAATATCTCGTTCTGGTCCCCAATTCTTCCATTCCCCAAGAAAGTTATCAATATGCGCGAGGGCAGTAGCGCCACCGGCCGCTACCGACACCGTCAAGGACCCTCTCCCCGCTGATCTCATCGTTCAAGAAACACA...

Protein

Download Protein FASTA

532 aa · TkA02G172170|TK1151|PROTEIN

MELCSSAPPTLSYLKSCVVSPPISSISFCNSFRPTNRFTSLKISRSGPQFFHSPRKLSICARAVAPPAATDTVKDPLPADLIVQETQEPNCRIRLNVEVPRIVCEDCYKRVINEFMKKAKVPGFRPGKNVPENILVSYIGKDGVRKATVESILKRTLPHAMSSVDGRALKDSIRITSTFPEMEKTYLSSNILKYDIIVDVAPEVKWVPEDGYKNLKIVVELDNEIDAKIACERELRRRYKSLGIMRIVTNRGLEIGDVAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G172170`
TK1151 ID	TkA02G172170
OH-1004 ID	LXL04_016213
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G172170

Location Chr02:44222178-44225689 (-)

Description Similar to TIG: Trigger factor-like protein TIG, Chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55220`	Involved in protein export.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016213 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0043335 protein unfolding Biological Process

GO:0051083 'de novo' cotranslational protein folding Biological Process

GO:0051301 cell division Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003755 peptidyl-prolyl cis-trans isomerase activity Molecular Function

GO:0043022 ribosome binding Molecular Function

KEGG gene cross-reference

ana:alr3681

ath:AT5G55220

ava:Ava_3605

mar:MAE_62700

ter:Tery_0586

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.961

Rank 1 · TkA02G172170 · TK1151

Mitochondrion0.065

Rank 2 · TkA02G172170 · TK1151

Cytoplasm0.023

Rank 3 · TkA02G172170 · TK1151

Nucleus0.015

Rank 4 · TkA02G172170 · TK1151

Cell membrane0.012

Rank 5 · TkA02G172170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05697Trigger_N84-220 aa

PF00254FKBP_C257-330 aa

PF05698Trigger_C364-521 aa

PF03945Endotoxin_N387-416 aa

PF22782SDE2409-491 aa

PF17085UCMA424-474 aa

PF03945Endotoxin_N438-511 aa

PF05697Trigger_N441-510 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G172170	`PF05697`	Trigger_N	84	220	4.5e-18	66.7
TkA02G172170	`PF00254`	FKBP_C	257	330	0.019	16.0
TkA02G172170	`PF05698`	Trigger_C	364	521	2.1e-21	77.4
TkA02G172170	`PF03945`	Endotoxin_N	387	416	1.3	9.4
TkA02G172170	`PF22782`	SDE2	409	491	1.6	10.3
TkA02G172170	`PF17085`	UCMA	424	474	1.3	9.8
TkA02G172170	`PF03945`	Endotoxin_N	438	511	1.3	9.4
TkA02G172170	`PF05697`	Trigger_N	441	510	4.5e-18	66.7
TkA02G172170	`PF21938`	CAP_N	477	527	0.081	13.7
TkA02G172170	`PF17085`	UCMA	485	503	1.3	9.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S9L5`	Arabidopsis thaliana	sp\|Q8S9L5\|TIG_ARATH Trigger factor-like protein TIG, Chloroplastic	68.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card