LXL04_016213 | RubberDandelionOmics

Gene overview

LXL04_016213

Reference: OH-1004 Chr: Chr03 Coordinates: 115453263-115456339 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1599 bp · LXL04_016213|LXL04_016213|OH1004|cDNA

ATGGAGCTATGCAGTTCGGCGCCTCCAACGTTATCCTATTTGAAATCTTGTGTTGTTTCCCCtccaatttcttcaatttctcTCTGCAACTCCTTCAGACCTACGAatcgattcacttctcttaGAATATCTCGTTCTGGTCCCCAATTCTTCCATTCCCCAAGAAAGTTATCAATATGCGCGAGGGCAGTAGCGCCACCGGCCGCTACCGACACCGTCAAAGACCCTCTCCCCGCTGATCTCATCGTTCAAGAAACACA...

CDS

Download CDS FASTA

1599 bp · LXL04_016213|LXL04_016213|OH1004|CDS

ATGGAGCTATGCAGTTCGGCGCCTCCAACGTTATCCTATTTGAAATCTTGTGTTGTTTCCCCTCCAATTTCTTCAATTTCTCTCTGCAACTCCTTCAGACCTACGAATCGATTCACTTCTCTTAGAATATCTCGTTCTGGTCCCCAATTCTTCCATTCCCCAAGAAAGTTATCAATATGCGCGAGGGCAGTAGCGCCACCGGCCGCTACCGACACCGTCAAAGACCCTCTCCCCGCTGATCTCATCGTTCAAGAAACACA...

Protein

Download Protein FASTA

532 aa · LXL04_016213|LXL04_016213|OH1004|PROTEIN

MELCSSAPPTLSYLKSCVVSPPISSISLCNSFRPTNRFTSLRISRSGPQFFHSPRKLSICARAVAPPAATDTVKDPLPADLIVQETQEPNCRIRLNVEVPRIVCEDCYKRVINEFMKKAKVPGFRPGKNVPENILVSYIGKDGVRKATVESILKRTLPHAMSSVDGRALKDSIRITSTFPEMEKTYLSSNILKYDIIVDVAPEVKWVPEDGYKNLKIVVELDNEIDAKTACERELRRRYKSLGIMRIVTNRGLEIGDVAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016213`
TK1151 ID	TkA02G172170
OH-1004 ID	LXL04_016213
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016213

Location Chr03:115453263-115456339 (-)

Description Similar to TIG: Trigger factor-like protein TIG, Chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55220`	Involved in protein export.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016213 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0043335 protein unfolding Biological Process

GO:0051083 'de novo' cotranslational protein folding Biological Process

GO:0051301 cell division Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003755 peptidyl-prolyl cis-trans isomerase activity Molecular Function

GO:0043022 ribosome binding Molecular Function

KEGG gene cross-reference

ana:alr3681

ath:AT5G55220

ava:Ava_3605

mar:MAE_62700

ter:Tery_0586

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.959

Rank 1 · LXL04_016213 · OH-1004

Mitochondrion0.068

Rank 2 · LXL04_016213 · OH-1004

Cytoplasm0.023

Rank 3 · LXL04_016213 · OH-1004

Nucleus0.016

Rank 4 · LXL04_016213 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_016213 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05697.19Trigger_N84-220 aa

PF05698.20Trigger_C364-521 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016213	`PF05697.19`	Trigger_N	84	220	4.7e-18	66.6
LXL04_016213	`PF05698.20`	Trigger_C	364	521	2.1e-21	77.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S9L5`	Arabidopsis thaliana	Trigger factor-like protein TIG, Chloroplastic	68.577%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card