TkA02G091630 | RubberDandelionOmics

Gene overview

TkA02G091630

Reference: TK1151 Chr: Chr02 Coordinates: 23866206-23871451 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1862 bp · TkA02G091630|TK1151|cDNA

TTTAAATAACACCCACGTTAACCCGCGAAATGCGCAACATCTCGAGACAACCCAGATTGAAAAGACGCTAAAAGTTGTCGACTTAGAGCGAGAGTGAGGCGAAAAAGCTTCCTTTGATGTGAAAAAATGGAGGAACAACATGAACTTATTAGGGAAGGAAGATCTTTAGCTGAAAACTCCAACATGGGCTGTTGCTACAACGATCACTTTCATGGTGTTTGCTTGCTGTTGGTTCAAAGATCTATTTACAGATTGGGGAG...

CDS

Download CDS FASTA

1059 bp · TkA02G091630|TK1151|CDS

ATGAGGCGCCAAGTCACTTTCATTAAACATCATGCAACACATCCATGGAGCAAGAGCCGGATTCTCATTTGGATGTTATGCTTTCTTCGACAGTTCAAAAGTCCAATGCGAAGGTCGGATTATGCTGCTTTGAGATTGGGGTTCATCACCACTCACAAATTGCCACTTTCTTATAATTTCCATAACTATATGGTCCGAAGCATGGAAGATGAATTTTATGAAATTGTGGGAATAAGTTGGCCACTTTGGGCTTATGCCAT...

Protein

Download Protein FASTA

352 aa · TkA02G091630|TK1151|PROTEIN

MRRQVTFIKHHATHPWSKSRILIWMLCFLRQFKSPMRRSDYAALRLGFITTHKLPLSYNFHNYMVRSMEDEFYEIVGISWPLWAYAILCICINIHGLNIYFWLSFVPVILVLLVGTKLQHVVSLLALEIGETRGPAARGAQVKPSDELFWFGKPEILLRLIQFISFQNAFEMATFIWSVWGFEQRSCFMKNHAMIVIRLTCGVLVQFWCSYSTVPLNVIVTQMGSRCKKALIAESVRDSLHSWCKRVKERSKTLHSVATR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G091630`
TK1151 ID	TkA02G091630
OH-1004 ID	LXL04_016931
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 63.196 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G091630

Location Chr02:23866206-23871451 (+)

Description Similar to MLO4: MLO-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11000`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At5g53760`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At1g26700`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At4g02600`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release
`At4g24250`	May be involved in modulation of pathogen defense and leaf cell death.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016931 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0010150 leaf senescence Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G11000

ath:AT1G26700

ath:AT2G39200

ath:AT4G02600

ath:AT5G53760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.818

Rank 1 · TkA02G091630 · TK1151

Endoplasmic reticulum0.112

Rank 2 · TkA02G091630 · TK1151

Cytoplasm0.105

Rank 3 · TkA02G091630 · TK1151

Nucleus0.062

Rank 4 · TkA02G091630 · TK1151

Lysosome / Vacuole0.053

Rank 5 · TkA02G091630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03094Mlo2-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G091630	`PF03094`	Mlo	2	262	4.5e-108	362.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23693`	Arabidopsis thaliana	sp\|O23693\|MLO4_ARATH MLO-like protein 4	62.700%	Swiss-Prot	High
`Q9FI00`	Arabidopsis thaliana	sp\|Q9FI00\|MLO11_ARATH MLO-like protein 11	52.800%	Swiss-Prot	High
`Q94KB1`	Arabidopsis thaliana	sp\|Q94KB1\|MLO14_ARATH MLO-like protein 14	48.600%	Swiss-Prot	Medium
`O49621`	Arabidopsis thaliana	sp\|O49621\|MLO1_ARATH MLO-like protein 1	49.000%	Swiss-Prot	Medium
`Q94KB2`	Arabidopsis thaliana	sp\|Q94KB2\|MLO13_ARATH MLO-like protein 13	43.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card