TkA02G091360 | RubberDandelionOmics

Gene overview

TkA02G091360

Reference: TK1151 Chr: Chr02 Coordinates: 23781888-23789284 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3122 bp · TkA02G091360|TK1151|cDNA

ATGTCAGAATATTTTAGATTTAATTTTTTATACCATAACTTTGTAAAACTTGCAGGGGACCTATCAGGAGATGTGAAAAACATAGAAGTAGACAGAAGATCTGGTTTTGTGGACTCTCTACTCAATGCTGACGTGTCAGATTCTGTTGTTTCTATGGATAAGGATCTCTCTGTACAAAATGATCATCAAATGTCTCATGATCTACCAGATAAAAGTCGTATTAATACGAATGCTGAAAGTGCTAGTTATCATAAAGAGGC...

CDS

Download CDS FASTA

708 bp · TkA02G091360|TK1151|CDS

ATGTCAGAATATTTTAGATTTAATTTTTTATACCATAACTTTGTAAAACTTGCAGGGGACCTATCAGGAGATGTGAAAAACATAGAAGTAGACAGAAGATCTGGTTTTGTGGACTCTCTACTCAATGCTGACGTGTCAGATTCTGTTGTTTCTATGGATAAGGATCTCTCTGTACAAAATGATCATCAAATGTCTCATGATCTACCAGATAAAAGTCGTATTAATACGAATGCTGAAAGTGCTAGTTATCATAAAGAGGC...

Protein

Download Protein FASTA

235 aa · TkA02G091360|TK1151|PROTEIN

MSEYFRFNFLYHNFVKLAGDLSGDVKNIEVDRRSGFVDSLLNADVSDSVVSMDKDLSVQNDHQMSHDLPDKSRINTNAESASYHKEAESSYLKKQQESKRKMKKYEDMLKVRGALPIAELKGEILHLLKDNDALVVCGETGCGKTTQVPQFILDDMIEGGHGGICNIVCTQPRRIAAISVAERVADERCESSPGSKDSLVGYQVRLDSARHERTKLLFCTTGILCEDDCGKQKLC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G091360`
TK1151 ID	TkA02G091360
OH-1004 ID	LXL04_016938
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 88.511 / OH-1004 14.566 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G091360

Location Chr02:23781888-23789284 (-)

Description Similar to At1g58060: DExH-box ATP-dependent RNA helicase DExH7, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g58060`	DExH-box ATP-dependent RNA helicase DExH7, chloroplastic.	No verified direct reference in this release
`At1g58050`	DExH-box ATP-dependent RNA helicase DExH4, chloroplastic.	No verified direct reference in this release
`At2g35920`	DExH-box ATP-dependent RNA helicase DExH1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016938 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0045727 positive regulation of translation Biological Process

GO:0045948 positive regulation of translational initiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016282 eukaryotic 43S preinitiation complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0003743 translation initiation factor activity Molecular Function

GO:0004386 helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G58050

ath:AT1G58060

ath:AT2G35920

hsa:90957

xla:100049090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.601

Rank 1 · TkA02G091360 · TK1151

Cytoplasm0.405

Rank 2 · TkA02G091360 · TK1151

Mitochondrion0.066

Rank 3 · TkA02G091360 · TK1151

Cell membrane0.051

Rank 4 · TkA02G091360 · TK1151

Endoplasmic reticulum0.046

Rank 5 · TkA02G091360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25366RUFY489-134 aa

PF20720nSTAND3124-158 aa

PF00270DEAD125-224 aa

PF00931NB-ARC127-178 aa

PF06745ATPase130-164 aa

PF13401AAA_22132-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G091360	`PF25366`	RUFY4	89	134	0.00027	21.9
TkA02G091360	`PF20720`	nSTAND3	124	158	0.0081	16.6
TkA02G091360	`PF00270`	DEAD	125	224	0.016	15.7
TkA02G091360	`PF00931`	NB-ARC	127	178	0.051	13.8
TkA02G091360	`PF06745`	ATPase	130	164	0.022	14.9
TkA02G091360	`PF13401`	AAA_22	132	152	0.039	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I9Q5`	Arabidopsis thaliana	sp\|F4I9Q5\|DEXH7_ARATH DExH-box ATP-dependent RNA helicase DExH7, chloroplastic	54.500%	Swiss-Prot	High
`Q9C6G0`	Arabidopsis thaliana	sp\|Q9C6G0\|DEXH4_ARATH DExH-box ATP-dependent RNA helicase DExH4, chloroplastic	69.700%	Swiss-Prot	Medium
`F4ILR7`	Arabidopsis thaliana	sp\|F4ILR7\|DEXH1_ARATH DExH-box ATP-dependent RNA helicase DExH1	57.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card