TkA02G042370 | RubberDandelionOmics

Gene overview

TkA02G042370

Reference: TK1151 Chr: Chr02 Coordinates: 10676387-10679221 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1234 bp · TkA02G042370|TK1151|cDNA

TATACGCTCTTCTCATCGCTTCAACTTCTCCTCGAGATCGAGGTGGGGTAGATAGCTCGCATTCAGAGACACAACTGAAGAGAACAAGATTCTTTGTACCATGAATGTGGCAGAGGATTTCCAAGAAACATTTGACAGGATTACACCGAAGGATAACAGCATCTTTCTTTTCCTATGGCATGTTGTCCACTTAATTCTTAGGGTATTATACCTTGCCCTAGAGATCTTTCAAACAGTCGAAAGCTACCTTATAACAAATC...

CDS

Download CDS FASTA

762 bp · TkA02G042370|TK1151|CDS

ATGACCATGAATGTGGCAGAGGATTTCCAAGAAACATTTGACAGGATTACACCGAAGGATAACAGCATCTTTCTTTTCCTATGGCATGTTGTCCACTTAATTCTTAGGGTATTATACCTTGCCCTAGAGATCTTTCAAACAGTCGAAAGCTACCTTATAACAAATCGAATAGTGAAAGCATATGGACATCTAAACTTACAAAGAGTAAATTATCTTGGAGTTGTCATAGACAGTGATGAAGCCCGTGAAACTGCTGAAGT...

Protein

Download Protein FASTA

253 aa · TkA02G042370|TK1151|PROTEIN

MTMNVAEDFQETFDRITPKDNSIFLFLWHVVHLILRVLYLALEIFQTVESYLITNRIVKAYGHLNLQRVNYLGVVIDSDEARETAEVIQLLEWLSDIGIKKVCLYDKEGVLKKSKEVLMERFNSVKQSNDDSELDALLNIKQIAFEFVSSSDGKEAVAKAANVLFKKYYSDGDTEKPFFTESYLTDALKTLGAVELDPDLLLVYGPARCHLGFPAWRIRYTEIVHMGPLKYKKHGLILKAIHKFTKVKQNYGS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G042370`
TK1151 ID	TkA02G042370
OH-1004 ID	LXL04_017466
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.605 / OH-1004 93.680 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G042370`
Location	Chr02:10676387-10679221 (-)
Description	Similar to NUS1: Dehydrodolichyl diphosphate synthase complex subunit NUS1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017466` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006489 dolichyl diphosphate biosynthetic process Biological Process GO:0030154 cell differentiation Biological Process GO:0032367 intracellular cholesterol transport Biological Process GO:0032383 regulation of intracellular cholesterol transport Biological Process GO:0035269 protein O-linked glycosylation via mannose Biological Process GO:0042632 cholesterol homeostasis Biological Process GO:0043048 dolichyl monophosphate biosynthetic process Biological Process GO:0055092 sterol homeostasis Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:1904423 dehydrodolichyl diphosphate synthase complex Cellular Component GO:0004659 prenyltransferase activity Molecular Function
KEGG gene cross-reference	dre:436629 hsa:116150 mmu:52014 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.374

Rank 1 · TkA02G042370 · TK1151

Nucleus0.211

Rank 2 · TkA02G042370 · TK1151

Mitochondrion0.178

Rank 3 · TkA02G042370 · TK1151

Cytoplasm0.117

Rank 4 · TkA02G042370 · TK1151

Golgi apparatus0.065

Rank 5 · TkA02G042370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14910MMS22L_N21-68 aa

PF08303tRNA_lig_kinase87-158 aa

PF14910MMS22L_N105-143 aa

PF26582ASCC3_N126-168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G042370	`PF14910`	MMS22L_N	21	68	0.47	9.6
TkA02G042370	`PF08303`	tRNA_lig_kinase	87	158	0.16	12.8
TkA02G042370	`PF14910`	MMS22L_N	105	143	0.47	9.6
TkA02G042370	`PF26582`	ASCC3_N	126	168	0.064	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card