TkA02G030920 | RubberDandelionOmics

Gene overview

TkA02G030920

Reference: TK1151 Chr: Chr02 Coordinates: 7483587-7488455 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2028 bp · TkA02G030920|TK1151|cDNA

ATTTTGAGTGCAAATACAAAAAGACATAATGCAAAACAAAACAAAACCAAAATCAAAATCAAAATCAAATCCCACGACTTTCTTAAATAAAAATCTTGAAAATGGAAACACTCAGATTCACCACAATTTTTGTTTTAGTCACGAGTCAGTAGTCACAACCTGATTCCATATTTGTTGCCGAGTCCACTGCTCATTCGACGACTCCATTTTCTCTCTCTCCCTCTTCCCATCTTCATAAATGGCGAAGTGGACTCTCCTTT...

CDS

Download CDS FASTA

1581 bp · TkA02G030920|TK1151|CDS

ATGGACGCCGAAGCAGACTCCGCCGAAAACACCATCGCCTCTTCTTCTCATTCATCCTTACAACAACCACCGACCACCATTCAATTTCCAGTCAACCTCGCCTGCAGTTCCGTAGTCGCGTCCGACGAAAATAAACAGACGATGGATTTCTTCGCCGATAGAAAGGACGTAGATGAACAGTCAAACTTTGACTGTGATACCTCCGATCATCGTCATCATACTATCAACACTGGATTGCATCTTCTTACTCGAAGTACGAG...

Protein

Download Protein FASTA

526 aa · TkA02G030920|TK1151|PROTEIN

MDAEADSAENTIASSSHSSLQQPPTTIQFPVNLACSSVVASDENKQTMDFFADRKDVDEQSNFDCDTSDHRHHTINTGLHLLTRSTSTDESVPDEGMSLDSKRTTMDAIHHFKQQLQEEMRENQRLKQELNKARLNYEALITAIKQKQEKNLDEYRKPSIDGGGGEIPFLGLADPVAMQIDENSRSSSEGRNHDEVSRKPINNHIYGKDQREESPEQALMCSNKVMRLNDVKTNDDGNIDQATEATIRKARVSVRARSEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G030920`
TK1151 ID	TkA02G030920
OH-1004 ID	LXL04_017563
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G030920

Location Chr02:7483587-7488455 (+)

Description Similar to WRKY6: WRKY transcription factor 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g62300`	Transcription factor involved in the control of processes related to senescence and pathogen defense.	Targets of AtWRKY6 regulation during plant senescence and pathogen defense.2002 · DOI: 10.1101/gad.222702 WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At4g04450`	Transcription factor.	WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At4g22070`	Transcription factor.	No verified direct reference in this release
`At4g01720`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0137500`	Transcription factor that acts as a positive regulator of leaf senescence.	OsWRKY5 Promotes Rice Leaf Senescence via Senescence-Associated NAC and Abscisic Acid Biosynthesis Pathway.2019 · DOI: 10.3390/ijms20184437 Inactivating transcription factor OsWRKY5 enhances drought tolerance through abscisic acid signaling pathways.2022 · DOI: 10.1093/plphys/kiab492

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017563 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0080169 cellular response to boron-containing substance deprivation Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:1901527 abscisic acid-activated signaling pathway involved in stomatal movement Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G62300

ath:AT4G01720

ath:AT4G04450

ath:AT4G22070

osa:107276141

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · TkA02G030920 · TK1151

Cytoplasm0.116

Rank 2 · TkA02G030920 · TK1151

Cell membrane0.020

Rank 3 · TkA02G030920 · TK1151

Mitochondrion0.011

Rank 4 · TkA02G030920 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA02G030920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12186AcylCoA_dehyd_C35-54 aa

PF06156YabA104-148 aa

PF12186AcylCoA_dehyd_C113-154 aa

PF03106WRKY265-322 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G030920	`PF12186`	AcylCoA_dehyd_C	35	54	0.78	10.6
TkA02G030920	`PF06156`	YabA	104	148	0.34	12.2
TkA02G030920	`PF12186`	AcylCoA_dehyd_C	113	154	0.78	10.6
TkA02G030920	`PF03106`	WRKY	265	322	1.3e-25	90.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C519`	Arabidopsis thaliana	sp\|Q9C519\|WRKY6_ARATH WRKY transcription factor 6	45.300%	Swiss-Prot	Medium
`Q9XEC3`	Arabidopsis thaliana	sp\|Q9XEC3\|WRK42_ARATH WRKY transcription factor 42	46.800%	Swiss-Prot	Medium
`Q93WT0`	Arabidopsis thaliana	sp\|Q93WT0\|WRK31_ARATH Probable WRKY transcription factor 31	41.200%	Swiss-Prot	Medium
`Q9ZSI7`	Arabidopsis thaliana	sp\|Q9ZSI7\|WRK47_ARATH Probable WRKY transcription factor 47	44.800%	Swiss-Prot	Medium
`Q75L34`	Oryza sativa subsp. japonica	sp\|Q75L34\|WRKY5_ORYSJ Transcription factor WRKY5	38.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card