LXL04_017563 | RubberDandelionOmics

Gene overview

LXL04_017563

Reference: OH-1004 Chr: Chr03 Coordinates: 153477237-153481658 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1581 bp · LXL04_017563|LXL04_017563|OH1004|cDNA

ATGGACGCCGAAGCAGACTCCGCCGAAAACACCATCGCCTCTTCTTCTCATTCATCCTTACAACAACCACCGACCACCATTCAATTTCCAGTCAACCTCGCCTGCAGTTCCGTAGTCGCGTCCGACGAAAATAAACAGACGATGGATTTCTTCGCCGATAGAAAGGACGTAGATGAACAGTCAAACTTTGACTGTGATACCTCCGATCATCGTCATCATACTATCAACACTGGATTGCATCTTCTTACTCGAAGTACGAG...

CDS

Download CDS FASTA

1581 bp · LXL04_017563|LXL04_017563|OH1004|CDS

ATGGACGCCGAAGCAGACTCCGCCGAAAACACCATCGCCTCTTCTTCTCATTCATCCTTACAACAACCACCGACCACCATTCAATTTCCAGTCAACCTCGCCTGCAGTTCCGTAGTCGCGTCCGACGAAAATAAACAGACGATGGATTTCTTCGCCGATAGAAAGGACGTAGATGAACAGTCAAACTTTGACTGTGATACCTCCGATCATCGTCATCATACTATCAACACTGGATTGCATCTTCTTACTCGAAGTACGAG...

Protein

Download Protein FASTA

526 aa · LXL04_017563|LXL04_017563|OH1004|PROTEIN

MDAEADSAENTIASSSHSSLQQPPTTIQFPVNLACSSVVASDENKQTMDFFADRKDVDEQSNFDCDTSDHRHHTINTGLHLLTRSTSTDESVPDEGMSLDSKRTTMDAIHHFKQQLQEEMRENQRLKQELNKARLNYEALITAIKQKQEKNLDEYRKPSIDGGGGEIPFLGLADPVAMQIDENSRSSSEGRNHDEVSRKPINNHIYGKDQREESPEQALMCSNKVMRLNDVKTNDDGNIDQATEATIRKARVSVRARSEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017563`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017563

Location Chr03:153477237-153481658 (-)

Description Similar to WRKY6: WRKY transcription factor 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g62300`	Transcription factor involved in the control of processes related to senescence and pathogen defense.	Targets of AtWRKY6 regulation during plant senescence and pathogen defense.2002 · DOI: 10.1101/gad.222702 WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At4g04450`	Transcription factor.	WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At4g22070`	Transcription factor.	No verified direct reference in this release
`At4g01720`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0137500`	Transcription factor that acts as a positive regulator of leaf senescence.	OsWRKY5 Promotes Rice Leaf Senescence via Senescence-Associated NAC and Abscisic Acid Biosynthesis Pathway.2019 · DOI: 10.3390/ijms20184437 Inactivating transcription factor OsWRKY5 enhances drought tolerance through abscisic acid signaling pathways.2022 · DOI: 10.1093/plphys/kiab492

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017563 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0080169 cellular response to boron-containing substance deprivation Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:1901527 abscisic acid-activated signaling pathway involved in stomatal movement Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G62300

ath:AT4G01720

ath:AT4G04450

ath:AT4G22070

osa:107276141

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_017563 · OH-1004

Cytoplasm0.116

Rank 2 · LXL04_017563 · OH-1004

Cell membrane0.020

Rank 3 · LXL04_017563 · OH-1004

Mitochondrion0.011

Rank 4 · LXL04_017563 · OH-1004

Endoplasmic reticulum0.009

Rank 5 · LXL04_017563 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY265-322 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017563	`PF03106.22`	WRKY	265	322	1.3e-25	90.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C519`	Arabidopsis thaliana	WRKY transcription factor 6	45.825%	Swiss-Prot	moderate database homology
`Q9XEC3`	Arabidopsis thaliana	WRKY transcription factor 42	43.264%	Swiss-Prot	moderate database homology
`Q93WT0`	Arabidopsis thaliana	Probable WRKY transcription factor 31	74.752%	Swiss-Prot	weak database homology
`Q9ZSI7`	Arabidopsis thaliana	Probable WRKY transcription factor 47	40.199%	Swiss-Prot	moderate database homology
`Q75L34`	Oryza sativa subsp. japonica	Transcription factor WRKY5	38.865%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card