TkA01G623870 | RubberDandelionOmics

Gene overview

TkA01G623870

Reference: TK1151 Chr: Chr01 Coordinates: 157473701-157474077 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

306 bp · TkA01G623870|TK1151|cDNA

ATGAACAGAAACAAGGACAACAGCAGTAATTTGAACTCCGTCTTCTACGCACAGACCTATCACCCGATCCAAGCCGGTAGCATCGACGACACCGACATTCTTCTTCACGATAACGCCGTCTACAGAGCTCTTCTATGTTCTTCAGTTGCCTCTGTATATGATCCCCTAAGTGATCCGAATGTTATCGGTGAAGATCCTTATTGCACCATTTTCGTCTGCCACCTCTCTCATTTGACTACCGAAGATACTCTTCGGTGTTG...

CDS

Download CDS FASTA

306 bp · TkA01G623870|TK1151|CDS

ATGAACAGAAACAAGGACAACAGCAGTAATTTGAACTCCGTCTTCTACGCACAGACCTATCACCCGATCCAAGCCGGTAGCATCGACGACACCGACATTCTTCTTCACGATAACGCCGTCTACAGAGCTCTTCTATGTTCTTCAGTTGCCTCTGTATATGATCCCCTAAGTGATCCGAATGTTATCGGTGAAGATCCTTATTGCACCATTTTCGTCTGCCACCTCTCTCATTTGACTACCGAAGATACTCTTCGGTGTTG...

Protein

Download Protein FASTA

101 aa · TkA01G623870|TK1151|PROTEIN

MNRNKDNSSNLNSVFYAQTYHPIQAGSIDDTDILLHDNAVYRALLCSSVASVYDPLSDPNVIGEDPYCTIFVCHLSHLTTEDTLRCWNYVIMSIYIKYIVS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G623870`
TK1151 ID	TkA01G623870
OH-1004 ID	LXL04_000263
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.000
Protein coverage (%)	TK1151 84.158 / OH-1004 22.051 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G623870

Location Chr01:157473701-157474077 (+)

Description Similar to SNRNP35: U11/U12 small nuclear ribonucleoprotein 35 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43370`	May facilitate 5' splice site recognition in the minor spliceosome.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000263 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0071016 U12-type precatalytic spliceosome Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43370

hsa:11066

mmu:76167

rno:360803

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.558

Rank 1 · TkA01G623870 · TK1151

Cytoplasm0.441

Rank 2 · TkA01G623870 · TK1151

Mitochondrion0.056

Rank 3 · TkA01G623870 · TK1151

Lysosome / Vacuole0.041

Rank 4 · TkA01G623870 · TK1151

Cell membrane0.036

Rank 5 · TkA01G623870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY74`	Arabidopsis thaliana	sp\|Q8VY74\|U1135_ARATH U11/U12 small nuclear ribonucleoprotein 35 kDa protein	65.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card