LXL04_000263 | RubberDandelionOmics

Gene overview

LXL04_000263

Reference: OH-1004 Chr: Chr01 Coordinates: 5015950-5018641 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1173 bp · LXL04_000263|LXL04_000263|OH1004|cDNA

ATGAACACGATGAACAGAAACAAGGACAACAGCAGTAATTTGAACTCCGTCTTCTACGCACAGACCTATCACCCGATCCAAGCCGGTAGCATCGACGACACCGACATTCTTCTTCACGATAACGCCGTCTACAGAGCTCTTCTATGTTCTTCAGTTGCCTCTGTATGCATCTTCCTCTTTTATGATCCGAATGTTATCGGTGAAGATCCTTATTGCACCGTTTTCGTCTGCCACCTCTCTCATTTGACTACCGAAGATAC...

CDS

Download CDS FASTA

1173 bp · LXL04_000263|LXL04_000263|OH1004|CDS

ATGAACACGATGAACAGAAACAAGGACAACAGCAGTAATTTGAACTCCGTCTTCTACGCACAGACCTATCACCCGATCCAAGCCGGTAGCATCGACGACACCGACATTCTTCTTCACGATAACGCCGTCTACAGAGCTCTTCTATGTTCTTCAGTTGCCTCTGTATGCATCTTCCTCTTTTATGATCCGAATGTTATCGGTGAAGATCCTTATTGCACCGTTTTCGTCTGCCACCTCTCTCATTTGACTACCGAAGATAC...

Protein

Download Protein FASTA

390 aa · LXL04_000263|LXL04_000263|OH1004|PROTEIN

MNTMNRNKDNSSNLNSVFYAQTYHPIQAGSIDDTDILLHDNAVYRALLCSSVASVCIFLFYDPNVIGEDPYCTVFVCHLSHLTTEDTLRKAMSKYGTVKNLRLVRHIVTGASRGYAFVEYESEREMQRAYEKGHRSVIDDSEILVDYNRQQLMLGWIPRRLGGGLGGKKESGQLRFGGSERHFHAPLRPIPLDDLKRLGIPPPPEGNYMSLSDKESETKPTTQLSAFFLTSSFPLRAVPDSFIFSFSTVVYKRKIFTIMF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000263`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000263

Location Chr01:5015950-5018641 (-)

Description Similar to SNRNP35: U11/U12 small nuclear ribonucleoprotein 35 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43370`	May facilitate 5' splice site recognition in the minor spliceosome.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000263 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0071016 U12-type precatalytic spliceosome Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43370

hsa:11066

mmu:76167

rno:360803

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.767

Rank 1 · LXL04_000263 · OH-1004

Cytoplasm0.304

Rank 2 · LXL04_000263 · OH-1004

Mitochondrion0.041

Rank 3 · LXL04_000263 · OH-1004

Cell membrane0.027

Rank 4 · LXL04_000263 · OH-1004

Endoplasmic reticulum0.020

Rank 5 · LXL04_000263 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_174-143 aa

PF03004.20Transposase_24262-368 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000263	`PF00076.29`	RRM_1	74	143	3.1e-16	59.7
LXL04_000263	`PF03004.20`	Transposase_24	262	368	2.4e-13	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY74`	Arabidopsis thaliana	U11/U12 small nuclear ribonucleoprotein 35 kDa protein	70.149%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card