TkA01G617690 | RubberDandelionOmics

Gene overview

TkA01G617690

Reference: TK1151 Chr: Chr01 Coordinates: 155887646-155891112 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2018 bp · TkA01G617690|TK1151|cDNA

TATACGATTTATGAATAAGTGTTTATAGTGGAAGTACAAAATTCAATAAGTGTTTATAGTGCGATGATAGAGACCAATAGTTTGACGAGACGGTTATTAAAATCTCTTTTAATTCCTTTAAAATCAACCATCCGACAAAAACGAAGAGCATAAATTGTTATAAAGATCCTAAAAGACTCTTCAAAATTAAATTATAGAGTCGTAAACAAACAAGAACTTCATATTATTTGACACTTAATAACGAAAAAGAAAGGGGGATT...

CDS

Download CDS FASTA

945 bp · TkA01G617690|TK1151|CDS

ATGTCCGATGAAGTGATAGTAAACGGCACCGGCGCCGATGTGGATGTAGACATTGAGGCGAAGGAAAAAGATTCCGACGGAAGTATGGATCTAACTGTTCAAAAATTGATGCAAAAGCTCGCTATTCTTGAGCAGGAAAAGCAAGAACTTATCAGCGATAAGGAATCGGCCACTAAGAAAATCGTGGAACTTGAGGATGAGATCCAGATGTCCGAATCCGATAAGAGGGCGTTGAGTTCGATTGCTTCAAGGGCGGCTGA...

Protein

Download Protein FASTA

314 aa · TkA01G617690|TK1151|PROTEIN

MSDEVIVNGTGADVDVDIEAKEKDSDGSMDLTVQKLMQKLAILEQEKQELISDKESATKKIVELEDEIQMSESDKRALSSIASRAAELETEVSRLQHDLISSMSDAQESNAELSQLKRVVEELKKSESEKAEKLAVIETERNLLLERLNEEAEKLKAEQNQIHELERKIQSFETGEFNQKRERLKVEEEAKSKISKKDEQIHSLNKMIDDYKSVIVKNRGDMEKSEKEKEELEIGKNDLEALLKKSERKVKEMEDRLDQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G617690`
TK1151 ID	TkA01G617690
OH-1004 ID	LXL04_000352
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G617690`
Location	Chr01:155887646-155891112 (+)
Description	Similar to PMD2: Peroxisomal and mitochondrial division factor 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000352` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007005 mitochondrion organization Biological Process GO:0007031 peroxisome organization Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005576 extracellular region Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005777 peroxisome Cellular Component GO:0005778 peroxisomal membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0031966 mitochondrial membrane Cellular Component GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	ath:AT1G06530 ath:AT3G58840 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.237

Rank 1 · TkA01G617690 · TK1151

Nucleus0.192

Rank 2 · TkA01G617690 · TK1151

Cytoplasm0.182

Rank 3 · TkA01G617690 · TK1151

Endoplasmic reticulum0.139

Rank 4 · TkA01G617690 · TK1151

Mitochondrion0.126

Rank 5 · TkA01G617690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05557MAD18-210 aa

PF27695CEP131_C19-77 aa

PF14073Cep57_CLD28-92 aa

PF23649FKBP1528-179 aa

PF03199GSH_synthase28-60 aa

PF17078SHE332-216 aa

PF08614ATG1634-190 aa

PF10473CENP-F_leu_zip34-164 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G617690	`PF05557`	MAD	18	210	3.5	6.6
TkA01G617690	`PF27695`	CEP131_C	19	77	1.9	8.2
TkA01G617690	`PF14073`	Cep57_CLD	28	92	0.026	15.3
TkA01G617690	`PF23649`	FKBP15	28	179	2.9	8.2
TkA01G617690	`PF03199`	GSH_synthase	28	60	3.0	9.1
TkA01G617690	`PF17078`	SHE3	32	216	2.3	8.6
TkA01G617690	`PF08614`	ATG16	34	190	0.00024	22.1
TkA01G617690	`PF10473`	CENP-F_leu_zip	34	164	0.0077	17.0
TkA01G617690	`PF10779`	XhlA	34	65	0.12	13.3
TkA01G617690	`PF00261`	Tropomyosin	34	272	1.4	9.0
TkA01G617690	`PF25994`	HH_AprE	34	124	2.3	9.0
TkA01G617690	`PF13851`	GAS	34	98	4.2	7.4
TkA01G617690	`PF28422`	CCDC89	34	190	8.0	6.4
TkA01G617690	`PF28968`	PMD1-like	35	270	3.1e-34	119.2
TkA01G617690	`PF30378`	CEP135_TSGA10_CC	36	269	2.3e-05	23.7
TkA01G617690	`PF27605`	ODF2_C	36	266	0.0025	17.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card