TkA01G609790 | RubberDandelionOmics

Gene overview

TkA01G609790

Reference: TK1151 Chr: Chr01 Coordinates: 153709681-153712418 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1509 bp · TkA01G609790|TK1151|cDNA

CAAAACCCTTTTTGGCTTTGAAATTTTCAAAGCAGATTCAATCACAGACGCTCCTGAGTCCGGACCCATTGAAGGCTTTACTCAGCGGTATATAAATGCTCTACTGATGCGTCTCTGTGGAAAAAATTCCGTTAATCATAATTTGGCGGGAGAGATATGGCGAACAAGCTAATAAGCGAAATGGGACTGCCGAAATCGATTGGGCACATATTCGCTGCTCGCAATATCATTACCGCCAAGGATGCTTTATCATTGACTGA...

CDS

Download CDS FASTA

780 bp · TkA01G609790|TK1151|CDS

ATGGCGAACAAGCTAATAAGCGAAATGGGACTGCCGAAATCGATTGGGCACATATTCGCTGCTCGCAATATCATTACCGCCAAGGATGCTTTATCATTGACTGAATTTGAGTTGATGGAACTGTTAGATGTGAGTCTTCCCCAAGTCACATTAGCAGTAGCTCTCATTAGTGAGATTGCTTCTCCTCCATATCAAACAGTGAGATCCATGTTGGAACATCGCATGCAAAATGAGTACCTGACAGGTCATCTTCCAACACA...

Protein

Download Protein FASTA

259 aa · TkA01G609790|TK1151|PROTEIN

MANKLISEMGLPKSIGHIFAARNIITAKDALSLTEFELMELLDVSLPQVTLAVALISEIASPPYQTVRSMLEHRMQNEYLTGHLPTHLKGLDAALCGGIPFGGLTELVGPAGIGKKQFCLKIALLATLPSCYGGLDGHVIYIDVESKFSSRRLIEIGINSFPDIFRLDGMAKEMAGRITVLRPGSLSEFTESLQKIKVSLIQHQVKLLVVDSMAALVSGEYEQGHSRAASIGLAYIIYQVRLYYLLLNFILTLTLSLTC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G609790`
TK1151 ID	TkA01G609790
OH-1004 ID	LXL04_000481
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 84.556 / OH-1004 12.882 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G609790

Location Chr01:153709681-153712418 (+)

Description Similar to RPPL1: Putative disease resistance RPP13-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28560`	May be involved in the homologous recombination repair (HRR) pathway of double-stranded DNA breaks arising during DNA replication or induced by DNA-damaging agents.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000481 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005657 replication fork Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0033063 Rad51B-Rad51C-Rad51D-XRCC2 complex Cellular Component

GO:0000150 DNA strand exchange activity Molecular Function

KEGG gene cross-reference

ath:AT2G28560

ath:AT3G14460

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.543

Rank 1 · TkA01G609790 · TK1151

Nucleus0.337

Rank 2 · TkA01G609790 · TK1151

Mitochondrion0.118

Rank 3 · TkA01G609790 · TK1151

Peroxisome0.113

Rank 4 · TkA01G609790 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA01G609790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26169HHH_XRCC3_RpoA6-59 aa

PF00536SAM_116-46 aa

PF00154RecA_N84-158 aa

PF08423Rad5185-222 aa

PF06745ATPase85-238 aa

PF13481AAA_2597-225 aa

PF00536SAM_1191-208 aa

PF00154RecA_N200-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G609790	`PF26169`	HHH_XRCC3_RpoA	6	59	2.2e-19	69.7
TkA01G609790	`PF00536`	SAM_1	16	46	0.17	13.0
TkA01G609790	`PF00154`	RecA_N	84	158	0.00065	20.0
TkA01G609790	`PF08423`	Rad51	85	222	1.5e-16	61.2
TkA01G609790	`PF06745`	ATPase	85	238	0.00012	22.2
TkA01G609790	`PF13481`	AAA_25	97	225	5.7e-05	23.5
TkA01G609790	`PF00536`	SAM_1	191	208	0.17	13.0
TkA01G609790	`PF00154`	RecA_N	200	233	0.00065	20.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SK02`	Arabidopsis thaliana	sp\|Q9SK02\|RA51B_ARATH DNA repair protein RAD51 homolog 2	68.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card