TkA01G554540 | RubberDandelionOmics

Gene overview

TkA01G554540

Reference: TK1151 Chr: Chr01 Coordinates: 139463989-139468459 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2929 bp · TkA01G554540|TK1151|cDNA

GAACCTGGAGGGTCTGTAGTAAAAATTACCCGATGAAACATGGACTGAGGTTCTTCCCCTCCCACGTTTAGGCCTAAAACCCTAAATTGAAATCTGAAAATCCTCAGGTGCCGACGAAGACGAGTTATTTCCTTCAATTCCTGATCATTTTACGTATTATTACCCTTTAATTTCTTTATTTTGGAAGATTATACGTTAAGGACAGGAATCGCAGCATGCAACATCTTCACAGAAAGCTAACGAGTAATAGGCCATCATTC...

CDS

Download CDS FASTA

1482 bp · TkA01G554540|TK1151|CDS

ATGCAACATCTTCACAGAAAGCTAACGAGTAATAGGCCATCATTCAAATTCGCCAATCAAGTTCGTACCTTTCTAGCAATCTCAGTTTTGGTCATACTCCGACATTTTTATTCAACATACAAGTGCTTTGATGCAGGGCAACCAACTCCGAACACTCATCCTCAGCTACTAAAAGAAGGCGAAATTACACCAGGAATCAGCTGTGATGAATACGTATCAAGGAGAAAGAAAATACTGGAACTTCTTCCAGAACAGAGTGT...

Protein

Download Protein FASTA

493 aa · TkA01G554540|TK1151|PROTEIN

MQHLHRKLTSNRPSFKFANQVRTFLAISVLVILRHFYSTYKCFDAGQPTPNTHPQLLKEGEITPGISCDEYVSRRKKILELLPEQSVAVIASAPIKMMTDVVPYTFRQDADYLYITGCQQPGGIAVLGHDFGLCMFMPEPTHQDITWQGQIAGVDAALEYFKADQSFPISKLNKVLPNMVKSCSKLYHNVKTAIPTYTELEAFKKAAYNGRLHDLSIYTHEARWVKSPSELNLMRQSASIGCQALLQTILQSKISPYENI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G554540`
TK1151 ID	TkA01G554540
OH-1004 ID	LXL04_002460
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	25.400
Protein coverage (%)	TK1151 75.456 / OH-1004 83.300 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G554540

Location Chr01:139463989-139468459 (+)

Description Similar to Pepd: Xaa-Pro dipeptidase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09300`	Aminopeptidase which cleaves preprotein intermediates that carry destabilizing N-ter amino acid residues after the mitochondrial processing peptidase (MPP) cleavage site and is thus critical for stabilization of the mitochondrial proteome.	Identification of cleavage sites and substrate proteins for two mitochondrial intermediate peptidases in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/erv064 INTERMEDIATE CLEAVAGE PEPTIDASE55 Modifies Enzyme Amino Termini and Alters Protein Stability in Arabidopsis Mitochondria.2015 · DOI: 10.1104/pp.15.00300 AtOMA1 Affects the OXPHOS System and Plant Growth in Contrast to Other Newly Identified ATP-Independent Proteases in Arabidopsis Mitochondria.2017 · DOI: 10.3389/fpls.2017.01543

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002460 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006520 amino acid metabolic process Biological Process

GO:0030574 collagen catabolic process Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0070062 extracellular exosome Cellular Component

GO:0004181 metallocarboxypeptidase activity Molecular Function

GO:0008233 peptidase activity Molecular Function

GO:0030145 manganese ion binding Molecular Function

GO:0070006 metalloaminopeptidase activity Molecular Function

GO:0102009 proline dipeptidase activity Molecular Function

KEGG gene cross-reference

ddi:DDB_G0269382

hsa:5184

mmu:18624

pon:100174216

rno:292808

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.810

Rank 1 · TkA01G554540 · TK1151

Cytoplasm0.127

Rank 2 · TkA01G554540 · TK1151

Nucleus0.073

Rank 3 · TkA01G554540 · TK1151

Plastid0.027

Rank 4 · TkA01G554540 · TK1151

Peroxisome0.027

Rank 5 · TkA01G554540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05195AMP_N71-187 aa

PF16834CSM2156-203 aa

PF00557Peptidase_M24233-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G554540	`PF05195`	AMP_N	71	187	4.8e-31	107.7
TkA01G554540	`PF16834`	CSM2	156	203	0.016	15.6
TkA01G554540	`PF00557`	Peptidase_M24	233	456	1.2e-50	172.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HZG9`	Arabidopsis thaliana	sp\|F4HZG9\|ICP55_ARATH Intermediate cleaving peptidase 55, mitochondrial	67.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card