LXL04_002460 | RubberDandelionOmics

Gene overview

LXL04_002460

Reference: OH-1004 Chr: Chr01 Coordinates: 49168084-49171226 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1512 bp · LXL04_002460|LXL04_002460|OH1004|cDNA

ATGGCGACGGTCGCCATGGATTCTTCTTCTTTGCTGTATCCTCCTCCCGAGGTCCCGAAAAAGCTTCACATTGAAAATCGAGAAAAACTGTTGAAACATCTCCGAGAAAGCCTAGTTTCATCCTCTCGTCCTTCACGCGGATTTGTGCTTCTTCAGGGTGGAGAAGAGCAAACTCGTTACTGCACCGACCATGAAGATATTTTTAGGCAGGAAAGTTATTTTGCATATCTGTTTGGAGTGCGGGAACCTGGTTTCTGTGG...

CDS

Download CDS FASTA

1512 bp · LXL04_002460|LXL04_002460|OH1004|CDS

ATGGCGACGGTCGCCATGGATTCTTCTTCTTTGCTGTATCCTCCTCCCGAGGTCCCGAAAAAGCTTCACATTGAAAATCGAGAAAAACTGTTGAAACATCTCCGAGAAAGCCTAGTTTCATCCTCTCGTCCTTCACGCGGATTTGTGCTTCTTCAGGGTGGAGAAGAGCAAACTCGTTACTGCACCGACCATGAAGATATTTTTAGGCAGGAAAGTTATTTTGCATATCTGTTTGGAGTGCGGGAACCTGGTTTCTGTGG...

Protein

Download Protein FASTA

503 aa · LXL04_002460|LXL04_002460|OH1004|PROTEIN

MATVAMDSSSLLYPPPEVPKKLHIENREKLLKHLRESLVSSSRPSRGFVLLQGGEEQTRYCTDHEDIFRQESYFAYLFGVREPGFCGAIDINTGNSILFAPRLPSEYAVWMGEIKPLSHFKETYTVNMVHYTDEITEVLNNLHQGPGKPLLFLLHGLNTDSKNFSKPATFEGIEKFETDLKTLHPILTECRVLKSKLEISMIQYANEISSEAHIEVMRKVKPEMKEYQLESTFLHHTYFYGSCRHCSYTCICATGDNSSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002460`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_002460`
Location	Chr01:49168084-49171226 (-)
Description	Similar to Pepd: Xaa-Pro dipeptidase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002460` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0006520 amino acid metabolic process Biological Process GO:0030574 collagen catabolic process Biological Process GO:0043069 negative regulation of programmed cell death Biological Process GO:0070062 extracellular exosome Cellular Component GO:0004181 metallocarboxypeptidase activity Molecular Function GO:0008233 peptidase activity Molecular Function GO:0030145 manganese ion binding Molecular Function GO:0070006 metalloaminopeptidase activity Molecular Function GO:0102009 proline dipeptidase activity Molecular Function
KEGG gene cross-reference	ddi:DDB_G0269382 hsa:5184 mmu:18624 pon:100174216 rno:292808 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.626

Rank 1 · LXL04_002460 · OH-1004

Nucleus0.228

Rank 2 · LXL04_002460 · OH-1004

Peroxisome0.141

Rank 3 · LXL04_002460 · OH-1004

Mitochondrion0.139

Rank 4 · LXL04_002460 · OH-1004

Cell membrane0.044

Rank 5 · LXL04_002460 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05195.23AMP_N23-145 aa

PF00557.30Peptidase_M24202-465 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002460	`PF05195.23`	AMP_N	23	145	1.2e-27	96.7
LXL04_002460	`PF00557.30`	Peptidase_M24	202	465	6e-53	180.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card