RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G542520
Reference: TK1151 Chr: Chr01 Coordinates: 136106196-136109100 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1554 bp · TkA01G542520|TK1151|cDNA

TTTCGTCAGGCTGGACTGCTGGAGGATTGACGTGGCCCACGCCTTCACCCATCTCTCTACTTCATCGTCTCCTTCCCTCATCCCTGAGTTTTATCAAAAACCTCGCTACTCCAATCACTCATTCCAGATTTCTCGATCTACAATTCTTAATTTATTATTCTTTACATCACTTTGATCGTTATGTCTCAGGTAAACGAGAAAGATGCCGCGGCCAAGCCTGCCACAGCCACGGAAAAGAAACCAGCCTCTGAATCAAGCTC...

CDS

Download CDS FASTA

1032 bp · TkA01G542520|TK1151|CDS

ATGTCTCAGGTAAACGAGAAAGATGCCGCGGCCAAGCCTGCCACAGCCACGGAAAAGAAACCAGCCTCTGAATCAAGCTCCTCAGATACACAACCTGGAAGCATACCTCCCATGCCTTCCATGCCTGGAGCTGGATTCCCTGCAAATCCTTTTGACTTTTCATCCATGGCTGGTCTACTCAACGACCCTAGCATTAAGGAATTAGCGGAACAAATAGCAAAAGATCCATCATTCAACCAAATGGCAGAACAACTTCAACA...

Protein

Download Protein FASTA

343 aa · TkA01G542520|TK1151|PROTEIN

MSQVNEKDAAAKPATATEKKPASESSSSDTQPGSIPPMPSMPGAGFPANPFDFSSMAGLLNDPSIKELAEQIAKDPSFNQMAEQLQQTFHAPDEGVPQFDTQQYYSTMQQVMQNPQFMTMAERLGNAMMQDPSMSQMLESLSNPAQKDQLEERMARIKEDPSLKPILEEIESGGPTAMMRYWNDQDVLKKLGEAMGLAVSEDATAASAGNEPEEDTNEDESIVHQTASVGDVEGLKKALESGADKDEEDSEGRTALHFAC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G542520
TK1151 IDTkA01G542520
OH-1004 IDLXL04_001367
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)93.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G542520
LocationChr01:136106196-136109100 (+)
DescriptionSimilar to AKR2B: Ankyrin repeat domain-containing protein 2B
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g17390 Exhibits chaperone activity toward chloroplast outer envelope membrane, mitochondrion outer membrane, endoplasmic reticulum membrane and peroxisomal proteins, by recruiting specific proteins containing a single transmembrane associated with an AKR2A-binding sequence (ABS) and subsequently binding glycolipids (e.g. monogalactosyldiacylglycerol (MGDG) and phosphatidylglycerol (PG)) present in the membrane of the target organelle. No verified direct reference in this release
At4g35450 Exhibits chaperone activity toward chloroplast outer envelope membrane, mitochondrion outer membrane, endoplasmic reticulum membrane and peroxisomal proteins, by recruiting specific proteins containing a single transmembrane associated with an AKR2A-binding sequence (ABS) and subsequently binding glycolipids (e.g. monogalactosyldiacylglycerol (MGDG) and phosphatidylglycerol (PG)) present in the membrane of the target organelle.
An ankyrin repeat-containing protein plays a role in both disease resistance and antioxidation metabolism.2002 · DOI: 10.1046/j.0960-7412.2001.01205.x
AKR2A-mediated import of chloroplast outer membrane proteins is essential for chloroplast biogenesis.2008 · DOI: 10.1038/ncb1683
ANKYRIN REPEAT-CONTAINING PROTEIN 2A is an essential molecular chaperone for peroxisomal membrane-bound ASCORBATE PEROXIDASE3 in Arabidopsis.2010 · DOI: 10.1105/tpc.109.065979

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001367 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000209 protein polyubiquitination Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006457 protein folding Biological Process
GO:0007052 mitotic spindle organization Biological Process
GO:0009791 post-embryonic development Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0015031 protein transport Biological Process
GO:0016055 Wnt signaling pathway Biological Process
GO:0018105 peptidyl-serine phosphorylation Biological Process
GO:0018107 peptidyl-threonine phosphorylation Biological Process
GO:0032210 regulation of telomere maintenance via telomerase Biological Process
GO:0032212 positive regulation of telomere maintenance via telomerase Biological Process
KEGG gene cross-reference
ath:AT2G17390
ath:AT4G35450
hsa:8658
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.725
Rank 1 · TkA01G542520 · TK1151
Nucleus0.311
Rank 2 · TkA01G542520 · TK1151
Peroxisome0.150
Rank 3 · TkA01G542520 · TK1151
Mitochondrion0.118
Rank 4 · TkA01G542520 · TK1151
Endoplasmic reticulum0.074
Rank 5 · TkA01G542520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16550RPN13_C55-93 aa
PF29340RsmA_N57-88 aa
PF17830STI1-HOP_DP58-81 aa
PF25575TPR_BSK1_C59-148 aa
PF07319DnaI_N65-84 aa
PF01984dsDNA_bind84-172 aa
PF25179LMF1_C95-148 aa
PF16550RPN13_C97-145 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G542520PF16550RPN13_C55930.212.5
TkA01G542520PF29340RsmA_N57880.04115.0
TkA01G542520PF17830STI1-HOP_DP58812.9e-1453.4
TkA01G542520PF25575TPR_BSK1_C591480.1412.8
TkA01G542520PF07319DnaI_N65840.04115.2
TkA01G542520PF01984dsDNA_bind841720.1513.0
TkA01G542520PF25179LMF1_C951480.2212.3
TkA01G542520PF16550RPN13_C971450.212.5
TkA01G542520PF17830STI1-HOP_DP1061192.9e-1453.4
TkA01G542520PF07319DnaI_N1061590.04115.2
TkA01G542520PF17898GerD1061550.05914.0
TkA01G542520PF29340RsmA_N1201430.04115.0
TkA01G542520PF17830STI1-HOP_DP1271452.9e-1453.4
TkA01G542520PF17830STI1-HOP_DP1521962.9e-1453.4
TkA01G542520PF29340RsmA_N1551700.04115.0
TkA01G542520PF12796Ank_22152809.7e-40135.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q29Q26Arabidopsis thalianasp|Q29Q26|AKR2B_ARATH Ankyrin repeat domain-containing protein 2B63.400%Swiss-ProtHigh
Q9SAR5Arabidopsis thalianasp|Q9SAR5|AKR2A_ARATH Ankyrin repeat domain-containing protein 2A53.700%Swiss-ProtMedium

JBrowse

View in Genome Browser