RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G518320
Reference: TK1151 Chr: Chr01 Coordinates: 129912101-129918481 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3168 bp · TkA01G518320|TK1151|cDNA

AAAAACCTCATTTTTGTCCCTTTTAGTATTGCAACCCTCCAACATAAAAGTTCTCTTGTAAGGATAGAAAGAGAGAGACGAGAGGAGATCTGCTCGTAAACTTCCAGTTGGGCTCACAATCCCGCTCATACCGACACAGAAGACAAAGATCTGATTCATCGTTGCAATCGATTGGACGTTTAGGCTTACAATTCTCATTCGTTTTCTCTAATGGCGCAGTACGTGAAGAAAGACGATGATCGCGATGAGGAAGAATACTC...

CDS

Download CDS FASTA

2652 bp · TkA01G518320|TK1151|CDS

ATGGCGCAGTACGTGAAGAAAGACGATGATCGCGATGAGGAAGAATACTCCCCCTTTTCTGGAATTGAGAAAGGAGCAGTTCTTCAGGAAGCTAGGGTCTTCAATGATCCTCAGTTAGATTCAAGGAGGTGCTCTCAGGTTATTACAAAGCTGCTTTATCTTCTGAATCAAGGTGATAGCTTCACAAAGGTTGAAGCCACAGAGGTTTTCTTTTCAGTGACAAAACTTTTCCAGTCTAAAGACATTGGATTAAGAAGAAT...

Protein

Download Protein FASTA

883 aa · TkA01G518320|TK1151|PROTEIN

MAQYVKKDDDRDEEEYSPFSGIEKGAVLQEARVFNDPQLDSRRCSQVITKLLYLLNQGDSFTKVEATEVFFSVTKLFQSKDIGLRRMVYLIIKELSPCADEVIIVTSSLMKDMNSKTDVYRANAIRVLCRITDGTLLTQIERYLKQAIVDKNPVVASAALVSGIHLLQTNPEIVKRWSNEVQEAVQSRAALVQFHALGLLHQIRQNDRLAVSKLVTSLTKGTVRSPLAQCLLIRYTSQVIREASMNNQTGDRPFYDYLES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G518320
TK1151 IDTkA01G518320
OH-1004 IDLXL04_001698
Relationship / confidenceMulti Candidate From Tk1151 / Complex relationship
Protein identity (%)95.900
Protein coverage (%)TK1151 99.094 / OH-1004 94.308
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G518320
LocationChr01:129912101-129918481 (-)
DescriptionSimilar to At4g34450: Coatomer subunit gamma
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g34450 The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0201100 The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. No verified direct reference in this release
Os03g0227000 The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001698 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006886 intracellular protein transport Biological Process
GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process
GO:0006891 intra-Golgi vesicle-mediated transport Biological Process
GO:0009306 protein secretion Biological Process
GO:0072384 organelle transport along microtubule Biological Process
GO:0000139 Golgi membrane Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005793 endoplasmic reticulum-Golgi intermediate compartment Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009506 plasmodesma Cellular Component
KEGG gene cross-reference
ath:AT4G34450
bta:536616
dosa:Os03g0227000
dosa:Os07g0201100
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.534
Rank 1 · TkA01G518320 · TK1151
Golgi apparatus0.384
Rank 2 · TkA01G518320 · TK1151
Nucleus0.181
Rank 3 · TkA01G518320 · TK1151
Endoplasmic reticulum0.120
Rank 4 · TkA01G518320 · TK1151
Lysosome / Vacuole0.115
Rank 5 · TkA01G518320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602Adaptin_N25-538 aa
PF27213VspR_N49-94 aa
PF24714TOR1L1_N90-95 aa
PF02985HEAT109-132 aa
PF13646HEAT_2114-160 aa
PF00514Arm119-130 aa
PF20168PDS5120-171 aa
PF12717Cnd1121-217 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G518320PF01602Adaptin_N255382.6e-141472.5
TkA01G518320PF27213VspR_N49940.06913.9
TkA01G518320PF24714TOR1L1_N90950.02114.9
TkA01G518320PF02985HEAT1091321.8e-0731.5
TkA01G518320PF13646HEAT_21141609.3e-1142.6
TkA01G518320PF00514Arm1191300.004617.7
TkA01G518320PF20168PDS51201710.0312.9
TkA01G518320PF12717Cnd11212172.3e-1351.2
TkA01G518320PF22928INTS1_R41362000.4211.3
TkA01G518320PF02985HEAT1441601.8e-0731.5
TkA01G518320PF16381Coatomer_g_Cpla1802169.1e-38129.6
TkA01G518320PF13646HEAT_21802249.3e-1142.6
TkA01G518320PF12717Cnd12502852.3e-1351.2
TkA01G518320PF02985HEAT2562821.8e-0731.5
TkA01G518320PF13646HEAT_22583179.3e-1142.6
TkA01G518320PF22928INTS1_R42592800.4211.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q0WW26Arabidopsis thalianasp|Q0WW26|COPG_ARATH Coatomer subunit gamma83.400%Swiss-ProtHigh
Q6Z382Oryza sativa subsp. japonicasp|Q6Z382|COPG2_ORYSJ Coatomer subunit gamma-283.700%Swiss-ProtHigh
Q8H852Oryza sativa subsp. japonicasp|Q8H852|COPG1_ORYSJ Coatomer subunit gamma-180.500%Swiss-ProtHigh

JBrowse

View in Genome Browser