TkA01G505000 | RubberDandelionOmics

Gene overview

TkA01G505000

Reference: TK1151 Chr: Chr01 Coordinates: 126463940-126465472 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

969 bp · TkA01G505000|TK1151|cDNA

GTCGGTTTTAACAAACAAAGTAAAGCCCGATAGTAATAGCCCATCATTAATGGGGTCATAAGTTCATATACATGGTCTGTGAATCTGTGTCTGTCTGCGTGTAACTCCGTGAGAAAAAGGGGGAAGCAGTTACAATGGAGGTGAGCTTGGAGGGTTCGAAAGCGATACTGGTAGCGTACACCAAGCAACACGTCCTCAAGTACCATCAATGGATGCAAGATCCTGCTCTTCTCCAAGCCACTGGCTCCGAGCCCTTGACC...

CDS

Download CDS FASTA

588 bp · TkA01G505000|TK1151|CDS

ATGGAGGTGAGCTTGGAGGGTTCGAAAGCGATACTGGTAGCGTACACCAAGCAACACGTCCTCAAGTACCATCAATGGATGCAAGATCCTGCTCTTCTCCAAGCCACTGGCTCCGAGCCCTTGACCCTCGAAGAAGAGTACCAGATGCAGCTTTCATGGACGCAAGACCCCCTCAAACGAACTTTTATCATCTTGGATAAAGATTTGATTTCTGGAAAATTCATTCATGGCGATCCTCATGATGAAGCCATGATAGGTGA...

Protein

Download Protein FASTA

195 aa · TkA01G505000|TK1151|PROTEIN

MEVSLEGSKAILVAYTKQHVLKYHQWMQDPALLQATGSEPLTLEEEYQMQLSWTQDPLKRTFIILDKDLISGKFIHGDPHDEAMIGDVNIYMNDLEDSNLAEIEIMIAEPKSRGKGLGKESVLMMTVFAIKNHKINTFRAKIGDSNEASLNMFRKLGFKEVSHSEIFKEVTLELPITAEKSKELIKLLGNMITHS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G505000`
TK1151 ID	TkA01G505000
OH-1004 ID	LXL04_001834
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G505000

Location Chr01:126463940-126465472 (-)

Description Similar to nat9: N-acetyltransferase 9-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04845`	Probable protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA) and epsilon-lysine acetylation (KA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001834 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:1901673 regulation of mitotic spindle assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

GO:0120519 tubulin N-terminal-methionine acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G04845

cel:CELE_Y67D2.5

hsa:26151

mmu:66176

nve:5506891

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.698

Rank 1 · TkA01G505000 · TK1151

Nucleus0.506

Rank 2 · TkA01G505000 · TK1151

Mitochondrion0.070

Rank 3 · TkA01G505000 · TK1151

Cell membrane0.046

Rank 4 · TkA01G505000 · TK1151

Peroxisome0.042

Rank 5 · TkA01G505000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13302Acetyltransf_311-159 aa

PF13420Acetyltransf_415-164 aa

PF13523Acetyltransf_818-162 aa

PF00583Acetyltransf_171-158 aa

PF13508Acetyltransf_782-160 aa

PF08445FR4796-164 aa

PF13673Acetyltransf_1099-167 aa

PF12746GNAT_acetyltran99-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G505000	`PF13302`	Acetyltransf_3	11	159	1.6e-16	62.0
TkA01G505000	`PF13420`	Acetyltransf_4	15	164	1.2e-05	26.1
TkA01G505000	`PF13523`	Acetyltransf_8	18	162	3.2e-05	24.3
TkA01G505000	`PF00583`	Acetyltransf_1	71	158	6.4e-08	33.6
TkA01G505000	`PF13508`	Acetyltransf_7	82	160	0.0011	20.0
TkA01G505000	`PF08445`	FR47	96	164	4.9e-06	27.1
TkA01G505000	`PF13673`	Acetyltransf_10	99	167	0.0059	17.3
TkA01G505000	`PF12746`	GNAT_acetyltran	99	162	0.012	15.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8E7`	Arabidopsis thaliana	sp\|Q8S8E7\|GNAT9_ARATH GCN5-related N-acetyltransferase 9	66.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card