TkA01G470610 | RubberDandelionOmics

Gene overview

TkA01G470610

Reference: TK1151 Chr: Chr01 Coordinates: 117808818-117809338 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

459 bp · TkA01G470610|TK1151|cDNA

AAAAGAAATCTAAAAACACCAAGAAAAAGAAAACCCATTACCGGAAATCACCAAAAGCCAAGATTTTCATCTGTTACGGATAATCACTACTATGATTGCTGCAGCACCGATGAAGAAGGAGAAAGCGACGGCGAAACCACTCTGTTTTCCTCCCGATCACTTTCTTCTGAGTCGTCGGTCTCTTTTCGCAAAAACGGAGAACGTCGATTAGCTCAGAAAAAACATAAGAAACCTACGGTGGCCGTGGATAGTGTTGCAGT...

CDS

Download CDS FASTA

459 bp · TkA01G470610|TK1151|CDS

AAAAGAAATCTAAAAACACCAAGAAAAAGAAAACCCATTACCGGAAATCACCAAAAGCCAAGATTTTCATCTGTTACGGATAATCACTACTATGATTGCTGCAGCACCGATGAAGAAGGAGAAAGCGACGGCGAAACCACTCTGTTTTCCTCCCGATCACTTTCTTCTGAGTCGTCGGTCTCTTTTCGCAAAAACGGAGAACGTCGATTAGCTCAGAAAAAACATAAGAAACCTACGGTGGCCGTGGATAGTGTTGCAGT...

Protein

Download Protein FASTA

152 aa · TkA01G470610|TK1151|PROTEIN

KRNLKTPRKRKPITGNHQKPRFSSVTDNHYYDCCSTDEEGESDGETTLFSSRSLSSESSVSFRKNGERRLAQKKHKKPTVAVDSVAVVKKSSDPHEDFRVSMLEMIVERQIFGAKDLENLLECFLSLNSQEHHRVIFEVFTEIWETLFSDWL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G470610`
TK1151 ID	TkA01G470610
OH-1004 ID	LXL04_002544
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	82.900
Protein coverage (%)	TK1151 86.184 / OH-1004 60.079 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G470610

Location Chr01:117808818-117809338 (-)

Description Similar to OFP8: Transcription repressor OFP8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19650`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At2g18500`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At3g52525`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At5g58360`	Transcriptional repressor that may regulate multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0864000`	Probable transcriptional repressor that regulates multiple aspects of plant growth and development, partly through brassinosteroid (BR) signaling pathway.	OVATE Family Protein 8 Positively Mediates Brassinosteroid Signaling through Interacting with the GSK3-like Kinase in Rice.2016 · DOI: 10.1371/journal.pgen.1006118

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002544 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0071548 response to dexamethasone Biological Process

GO:2000652 regulation of secondary cell wall biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G06920

ath:AT2G18500

ath:AT2G30400

ath:AT3G52525

ath:AT5G19650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · TkA01G470610 · TK1151

Nucleus0.394

Rank 2 · TkA01G470610 · TK1151

Cell membrane0.266

Rank 3 · TkA01G470610 · TK1151

Endoplasmic reticulum0.075

Rank 4 · TkA01G470610 · TK1151

Plastid0.047

Rank 5 · TkA01G470610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04844Ovate91-148 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G470610	`PF04844`	Ovate	91	148	1.5e-25	89.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E9B4`	Arabidopsis thaliana	sp\|Q3E9B4\|OFP8_ARATH Transcription repressor OFP8	55.300%	Swiss-Prot	Medium
`Q9ZU65`	Arabidopsis thaliana	sp\|Q9ZU65\|OFP7_ARATH Transcription repressor OFP7	61.400%	Swiss-Prot	Low
`Q3EAL1`	Arabidopsis thaliana	sp\|Q3EAL1\|OFP6_ARATH Transcription repressor OFP6	55.700%	Swiss-Prot	Low
`Q9LVL4`	Arabidopsis thaliana	sp\|Q9LVL4\|OFP3_ARATH Transcription repressor OFP3	48.800%	Swiss-Prot	Medium
`Q94CV1`	Oryza sativa subsp. japonica	sp\|Q94CV1\|OFP8_ORYSJ Transcription repressor OFP8	50.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card