Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1349 bp · TkA01G460870|TK1151|cDNA
CAAAACTTGAGGACTTCAGCCTTAAAAAAAAACCAATTCGCTCTTCGAGGAGCAGGACTCAGGAAGACAGGAACGATCATTCTCCTTCGTCGATTGTTTCTAGGGTTCTCCATTGCAGTAGTATCAATGGAATCGACAACAGCAAACGATCCGATGATCGACACTAACAACGACGAAGAATCTACGCTGCTGACTATCCTCGACGCCTCCAGCTATCAGCTCCATGATCTCGACTCAATCGAGTTACCGCCGACCCTCAT...
1128 bp · TkA01G460870|TK1151|CDS
CAAAACTTGAGGACTTCAGCCTTAAAAAAAAACCAATTCGCTCTTCGAGGAGCAGGACTCAGGAAGACAGGAACGATCATTCTCCTTCGTCGATTGTTTCTAGGGTTCTCCATTGCAGTAGTATCAATGGAATCGACAACAGCAAACGATCCGATGATCGACACTAACAACGACGAAGAATCTACGCTGCTGACTATCCTCGACGCCTCCAGCTATCAGCTCCATGATCTCGACTCAATCGAGTTACCGCCGACCCTCAT...
Protein
Download Protein FASTA375 aa · TkA01G460870|TK1151|PROTEIN
QNLRTSALKKNQFALRGAGLRKTGTIILLRRLFLGFSIAVVSMESTTANDPMIDTNNDEESTLLTILDASSYQLHDLDSIELPPTLIEIDLTANRLTKLDSRISHLSSLKKLSLRQNLFNDSGVEPISQWNTISGLEELVLRDNQLKKIPDVSIFKTLLVFDVSFNEITSMSGLSNASSTLKELYVSKNEVTKIEEIEHFHQLQILELGSNRLRVIENLQNLTKLQELWLGRNRIKSINLCGLKCIKKLSLQSNRLTSMK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G460870 |
|---|---|
| TK1151 ID | TkA01G460870 |
| OH-1004 ID | LXL04_002501 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.700 |
| Protein coverage (%) | TK1151 91.733 / OH-1004 98.006Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G460870 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr01:115468076-115470544 (-) | ||||||
| Description | Similar to At5g19680: Protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0007059 chromosome segregation Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0034504 protein localization to nucleus Biological Process GO:0005634 nucleus Cellular Component GO:0005694 chromosome Cellular Component GO:0005737 cytoplasm Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0004864 protein phosphatase inhibitor activity Molecular Function GO:0019888 protein phosphatase regulator activity Molecular Function GO:0030234 enzyme regulator activity Molecular Function | ||||||
| KEGG gene cross-reference | ath:AT5G19680 ddi:DDB_G0284039 hsa:5510 mmu:66385 pon:100171414 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF29460LRR_NXF255-117 aaPF24048LRR_NXF1-562-115 aaPF12799LRR_464-82 aaPF00560LRR_164-76 aaPF25013LRR_Zer-164-115 aaPF12799LRR_484-119 aaPF13516LRR_684-97 aaPF24048LRR_NXF1-584-147 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G460870 | PF29460 | LRR_NXF2 | 55 | 117 | 3.6e-05 | 24.3 |
| TkA01G460870 | PF24048 | LRR_NXF1-5 | 62 | 115 | 1.3e-07 | 32.1 |
| TkA01G460870 | PF12799 | LRR_4 | 64 | 82 | 1.4e-36 | 124.4 |
| TkA01G460870 | PF00560 | LRR_1 | 64 | 76 | 2.3e-11 | 42.2 |
| TkA01G460870 | PF25013 | LRR_Zer-1 | 64 | 115 | 3.8 | 8.4 |
| TkA01G460870 | PF12799 | LRR_4 | 84 | 119 | 1.4e-36 | 124.4 |
| TkA01G460870 | PF13516 | LRR_6 | 84 | 97 | 1e-09 | 38.4 |
| TkA01G460870 | PF24048 | LRR_NXF1-5 | 84 | 147 | 1.3e-07 | 32.1 |
| TkA01G460870 | PF13855 | LRR_8 | 85 | 119 | 8.7e-23 | 80.6 |
| TkA01G460870 | PF00560 | LRR_1 | 86 | 104 | 2.3e-11 | 42.2 |
| TkA01G460870 | PF23211 | LRR_LRWD1 | 86 | 149 | 0.023 | 15.1 |
| TkA01G460870 | PF14580 | LRR_9 | 89 | 177 | 2.6e-13 | 50.6 |
| TkA01G460870 | PF23598 | LRR_14 | 90 | 117 | 0.00018 | 21.1 |
| TkA01G460870 | PF23952 | LRR_EndoS | 103 | 166 | 6.5e-05 | 23.9 |
| TkA01G460870 | PF13516 | LRR_6 | 105 | 128 | 1e-09 | 38.4 |
| TkA01G460870 | PF25013 | LRR_Zer-1 | 105 | 184 | 3.8 | 8.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q84WJ9 | Arabidopsis thaliana | sp|Q84WJ9|PP1R7_ARATH Protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog | 77.700% | Swiss-Prot | High |