RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G440580
Reference: TK1151 Chr: Chr01 Coordinates: 110091348-110095538 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4191 bp · TkA01G440580|TK1151|cDNA

ATGGGGAAACAAGAAGAAGAGGAGGAGGAGGTGGACGACGAGGAGGAAGACGATGACGATGATGATGAAGATGATGACGAAGAAGACGATGACAAAACAATCAAAATCAGAAAATCAAAAGAACTGGGAATTTCCTGTATGTTGAATACAGAGGTCGGAGCGGTTCTGGCAGTTATCCGCCGCAGATCCGACCCAACCTCATATATTTACCAAGATGACGCCTTGGATTCCAATATACTAAGTTCGCTAAAATCACTAAG...

CDS

Download CDS FASTA

4191 bp · TkA01G440580|TK1151|CDS

ATGGGGAAACAAGAAGAAGAGGAGGAGGAGGTGGACGACGAGGAGGAAGACGATGACGATGATGATGAAGATGATGACGAAGAAGACGATGACAAAACAATCAAAATCAGAAAATCAAAAGAACTGGGAATTTCCTGTATGTTGAATACAGAGGTCGGAGCGGTTCTGGCAGTTATCCGCCGCAGATCCGACCCAACCTCATATATTTACCAAGATGACGCCTTGGATTCCAATATACTAAGTTCGCTAAAATCACTAAG...

Protein

Download Protein FASTA

1396 aa · TkA01G440580|TK1151|PROTEIN

MGKQEEEEEEVDDEEEDDDDDDEDDDEEDDDKTIKIRKSKELGISCMLNTEVGAVLAVIRRRSDPTSYIYQDDALDSNILSSLKSLRSLIFNPRQSWRAIDPSIYLSPFLDVISSEDVPAAATTVALSSILKMLKLDIFDKKTPGAREAVSNVVMAVTGCRLEKTHPVTEAAVMMRILQVLAAVMRHPASVLLNDHAVCTIVNTCFQVVQQSASQGDILQRTARHTMHDLIQIIYSRLLEIEVGDWENSESDTEDATDET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G440580
TK1151 IDTkA01G440580
OH-1004 IDLXL04_002565
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 97.779 / OH-1004 97.779
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G440580
LocationChr01:110091348-110095538 (-)
DescriptionSimilar to GNL2: ARF guanine-nucleotide exchange factor GNL2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g19610 Activates the ARF proteins by exchanging bound GDP for free GTP.
GNOM-LIKE 2, encoding an adenosine diphosphate-ribosylation factor-guanine nucleotide exchange factor protein homologous to GNOM and GNL1, is essential for pollen germination in Arabidopsis.2009 · DOI: 10.1111/j.1744-7909.2009.00858.x
At1g13980 Activates the ARF proteins by exchanging bound GDP for free GTP.
Cell wall alterations in the arabidopsis emb30 mutant.2000 · DOI: 10.1105/tpc.12.11.2047
EMB30 is essential for normal cell division, cell expansion, and cell adhesion in Arabidopsis and encodes a protein that has similarity to Sec7.1994 · DOI: 10.1016/0092-8674(94)90444-8
At5g39500 Activates the ARF proteins by exchanging bound GDP for free GTP.
Functional diversification of closely related ARF-GEFs in protein secretion and recycling.2007 · DOI: 10.1038/nature05967
An ARF-GEF acting at the Golgi and in selective endocytosis in polarized plant cells.2007 · DOI: 10.1038/nature06023
GNOM-LIKE1/ERMO1 and SEC24a/ERMO2 are required for maintenance of endoplasmic reticulum morphology in Arabidopsis thaliana.2009 · DOI: 10.1105/tpc.109.068270

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_002565 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000911 cytokinesis by cell plate formation Biological Process
GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process
GO:0006897 endocytosis Biological Process
GO:0007005 mitochondrion organization Biological Process
GO:0007029 endoplasmic reticulum organization Biological Process
GO:0007030 Golgi organization Biological Process
GO:0007155 cell adhesion Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0009846 pollen germination Biological Process
GO:0009880 embryonic pattern specification Biological Process
GO:0009942 longitudinal axis specification Biological Process
KEGG gene cross-reference
ath:AT1G13980
ath:AT5G19610
ath:AT5G39500
cel:CELE_C24H11.7
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.523
Rank 1 · TkA01G440580 · TK1151
Golgi apparatus0.283
Rank 2 · TkA01G440580 · TK1151
Cell membrane0.191
Rank 3 · TkA01G440580 · TK1151
Nucleus0.149
Rank 4 · TkA01G440580 · TK1151
Lysosome / Vacuole0.145
Rank 5 · TkA01G440580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05470eIF-3c_N4-259 aa
PF04931DNA_pol_phi5-32 aa
PF04546Sigma70_ner6-32 aa
PF02724CDC456-32 aa
PF09324Sec7-like_HDS106-135 aa
PF23325TPR_28118-192 aa
PF12783Sec7-like_HUS264-423 aa
PF01369Sec7513-698 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G440580PF05470eIF-3c_N42590.03313.3
TkA01G440580PF04931DNA_pol_phi5323.36.4
TkA01G440580PF04546Sigma70_ner6323.38.3
TkA01G440580PF02724CDC456329.15.1
TkA01G440580PF09324Sec7-like_HDS1061350.001519.0
TkA01G440580PF23325TPR_281181922.6e-40138.8
TkA01G440580PF12783Sec7-like_HUS2644237.8e-35120.8
TkA01G440580PF01369Sec75136983.8e-68229.4
TkA01G440580PF09324Sec7-like_HDS8308510.001519.0
TkA01G440580PF12783Sec7-like_HUS8959317.8e-35120.8
TkA01G440580PF29904THR_N96610610.0214.6
TkA01G440580PF04931DNA_pol_phi105511683.36.4
TkA01G440580PF09324Sec7-like_HDS106711050.001519.0
TkA01G440580PF05470eIF-3c_N117912200.03313.3
TkA01G440580PF23325TPR_28120713832.6e-40138.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4K2K3Arabidopsis thalianasp|F4K2K3|GNL2_ARATH ARF guanine-nucleotide exchange factor GNL262.100%Swiss-ProtHigh
Q42510Arabidopsis thalianasp|Q42510|GNOM_ARATH ARF guanine-nucleotide exchange factor GNOM40.200%Swiss-ProtMedium
Q9FLY5Arabidopsis thalianasp|Q9FLY5|GNL1_ARATH ARF guanine-nucleotide exchange factor GNL137.100%Swiss-ProtMedium

JBrowse

View in Genome Browser