TkA01G436850 | RubberDandelionOmics

Gene overview

TkA01G436850

Reference: TK1151 Chr: Chr01 Coordinates: 109164563-109169535 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1458 bp · TkA01G436850|TK1151|cDNA

ATGACTATGCCCGTACTCTTGAGGTACGTTATGGACAATACTAGCGTTATTGGGTTGACCACCCCGCATTGGGACGCTAAGGAAGCAAGAATCGTGTTTGTGTTCTTGGCTGTTGCTGTCAGTGTCTTGCTGTTGCTGTGTCACTGTGATACCCGAAGTCAAAACGTCTGTAGTCTGCGGACAACATCTGCAAAGCTCTGCAGAAGAAGAGGTGGCCCAAACGCCGAGCCCAACAATTGGCCCAGAACTCCATCGTTTAC...

CDS

Download CDS FASTA

1458 bp · TkA01G436850|TK1151|CDS

ATGACTATGCCCGTACTCTTGAGGTACGTTATGGACAATACTAGCGTTATTGGGTTGACCACCCCGCATTGGGACGCTAAGGAAGCAAGAATCGTGTTTGTGTTCTTGGCTGTTGCTGTCAGTGTCTTGCTGTTGCTGTGTCACTGTGATACCCGAAGTCAAAACGTCTGTAGTCTGCGGACAACATCTGCAAAGCTCTGCAGAAGAAGAGGTGGCCCAAACGCCGAGCCCAACAATTGGCCCAGAACTCCATCGTTTAC...

Protein

Download Protein FASTA

485 aa · TkA01G436850|TK1151|PROTEIN

MTMPVLLRYVMDNTSVIGLTTPHWDAKEARIVFVFLAVAVSVLLLLCHCDTRSQNVCSLRTTSAKLCRRRGGPNAEPNNWPRTPSFTASHDSKDRTPGRRSIRWRVLHLRSVESELCNMDLRAIGGKTLPDLSTLRKFSHFDGPKVSSARDISKSSVAESSGVSSGKRLLRLKLTDGHSDITAIEFTHIPSIPDNIVPGTKIRLENKVVMHSGILCLNAKAVTVLGGVVPSLYEEWEMNQKYAGFTRSTLKLSHGDDTGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G436850`
TK1151 ID	TkA01G436850
OH-1004 ID	LXL04_002601
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.600
Protein coverage (%)	TK1151 72.577 / OH-1004 84.065 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G436850`
Location	Chr01:109164563-109169535 (+)
Description	Similar to TDRD3: Tudor domain-containing protein 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002601` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006265 DNA topological change Biological Process GO:0141194 siRNA-mediated heterochromatin formation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:0035145 exon-exon junction complex Cellular Component GO:0140225 DNA topoisomerase III-beta-TDRD3 complex Cellular Component GO:0003682 chromatin binding Molecular Function GO:0003713 transcription coactivator activity Molecular Function GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	bta:537918 gga:418823 mmu:219249 xtr:395019 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.694

Rank 1 · TkA01G436850 · TK1151

Cytoplasm0.325

Rank 2 · TkA01G436850 · TK1151

Cell membrane0.060

Rank 3 · TkA01G436850 · TK1151

Endoplasmic reticulum0.047

Rank 4 · TkA01G436850 · TK1151

Golgi apparatus0.030

Rank 5 · TkA01G436850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08585RMI1_N_C159-238 aa

PF05918API5310-376 aa

PF25698EBNA2_Core355-382 aa

PF05918API5398-476 aa

PF08585RMI1_N_C434-448 aa

PF17228SGP450-482 aa

PF25698EBNA2_Core456-483 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G436850	`PF08585`	RMI1_N_C	159	238	6.2e-18	65.7
TkA01G436850	`PF05918`	API5	310	376	6.7	6.2
TkA01G436850	`PF25698`	EBNA2_Core	355	382	2.2	7.9
TkA01G436850	`PF05918`	API5	398	476	6.7	6.2
TkA01G436850	`PF08585`	RMI1_N_C	434	448	6.2e-18	65.7
TkA01G436850	`PF17228`	SGP	450	482	4.6	8.8
TkA01G436850	`PF25698`	EBNA2_Core	456	483	2.2	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card