Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3626 bp · TkA01G422250|TK1151|cDNA
TTTAAGACGAAACTTCCAAAACAAATACTATCTGATTTGCAAATTGGTGCGCTGCACAAAGCACACACATCTGATTTTGGAACCCACCTGCACATCGCCTGCCTCTGCTTGGCCGATTGTTGCTCTTCTCCCGTCTGTTGTCGCCATCCGCCGATCAGAACCACCGGCTACGCTTCAAACATTCGTCAGATCCACCGATGTTCGCTCCCCAACCAGGCTCACACCACTGGAAAGGCGCTCCGCTCCCCAGCTTAGCCGTC...
2973 bp · TkA01G422250|TK1151|CDS
ATGGATGACAGCTTATATGATGAGTTTGGAAACTACATTGGACCTGAAATCGAGTCTGATCAAGACAGTGACAGAGAAGATGAAGATGAAGATCTCCCAGAAAAGCCTGAAGACGAAAGAGCTGATTCTGATGAAGAGAATGGAACTGCTGGACCCAATGGATGGATGACAACTGGCGATAATGATATCGATATGGACAATCAAATCGTCCTTGCAGAAGACAAAAAGTATTACCCTACTGCAGAAGAAGTGTATGGTGA...
Protein
Download Protein FASTA990 aa · TkA01G422250|TK1151|PROTEIN
MDDSLYDEFGNYIGPEIESDQDSDREDEDEDLPEKPEDERADSDEENGTAGPNGWMTTGDNDIDMDNQIVLAEDKKYYPTAEEVYGEEVETLVMDEDEQPLELPIIKPVRDIKFEVGVKDSSTYVSTEFLLGLSSNPTLVRNVALVGHLQHGKTVFMDMLVEQTHHISTFDQNSEKHMRYTDTRVDEQERRISIKAVPMSLVLEDSNSKSYMCNIMDTPGHVNFSDEMTAALRLADGAVLIVDAAEGVMVNTERAIRHAI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G422250 |
|---|---|
| TK1151 ID | TkA01G422250 |
| OH-1004 ID | LXL04_037178 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 38.400 |
| Protein coverage (%) | TK1151 84.343 / OH-1004 88.901Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G422250 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:105442004-105447406 (+) | |||||||||
| Description | Similar to LOS1: Elongation factor 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0002182 cytoplasmic translational elongation Biological Process GO:0006414 translational elongation Biological Process GO:0009409 response to cold Biological Process GO:0009631 cold acclimation Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component GO:0009507 chloroplast Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G56070 bvg:104906141 ncr:NCU07700 spo:2539544 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16004EFTUD23-120 aaPF00009GTP_EFTU140-333 aaPF09439SRPRB141-243 aaPF01926MMR_HSR1142-272 aaPF00735Septin142-262 aaPF00350Dynamin_N143-163 aaPF25118EFL1158-179 aaPF00350Dynamin_N163-272 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G422250 | PF16004 | EFTUD2 | 3 | 120 | 4.7e-35 | 121.6 |
| TkA01G422250 | PF00009 | GTP_EFTU | 140 | 333 | 1.4e-43 | 149.5 |
| TkA01G422250 | PF09439 | SRPRB | 141 | 243 | 0.11 | 12.6 |
| TkA01G422250 | PF01926 | MMR_HSR1 | 142 | 272 | 0.00011 | 22.9 |
| TkA01G422250 | PF00735 | Septin | 142 | 262 | 0.066 | 13.2 |
| TkA01G422250 | PF00350 | Dynamin_N | 143 | 163 | 0.1 | 13.3 |
| TkA01G422250 | PF25118 | EFL1 | 158 | 179 | 3.3e-05 | 25.2 |
| TkA01G422250 | PF00350 | Dynamin_N | 163 | 272 | 0.1 | 13.3 |
| TkA01G422250 | PF08477 | Roc | 179 | 274 | 0.0022 | 18.9 |
| TkA01G422250 | PF00071 | Ras | 185 | 274 | 0.13 | 12.5 |
| TkA01G422250 | PF03144 | GTP_EFTU_D2 | 509 | 583 | 6e-10 | 40.1 |
| TkA01G422250 | PF22042 | EF-G_D2 | 509 | 584 | 0.019 | 15.8 |
| TkA01G422250 | PF14492 | EFG_III | 603 | 671 | 2.4e-05 | 25.0 |
| TkA01G422250 | PF03764 | EFG_IV | 726 | 840 | 8.4e-21 | 74.7 |
| TkA01G422250 | PF25118 | EFL1 | 734 | 764 | 3.3e-05 | 25.2 |
| TkA01G422250 | PF00679 | EFG_C | 843 | 931 | 8.8e-23 | 80.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.