TkA01G418400 | RubberDandelionOmics

Gene overview

TkA01G418400

Reference: TK1151 Chr: Chr01 Coordinates: 104479393-104481458 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1405 bp · TkA01G418400|TK1151|cDNA

TAATAAAACCCTGATTATCGTGTTTGATGCGTGCGTGCCTTCTCTCCGCATTGTCGCTTGCTGCCTGCTGCTCACTTCGCCATTGAAGAATCCTCCGAGTTTTGAAAATGGAAAATACACAAGAACCAGAGGAAAGCCAGATCCAAGAAACAGAAACCCGCGAGGAGATGCTTTCTAGGCACAGAAAAGAGATCACTCAGTTACAAAACAAGGAAATTGCCCTAAAAAAAGCAGCAGCTAAAGGCAGCAAAGCGGAGCAA...

CDS

Download CDS FASTA

921 bp · TkA01G418400|TK1151|CDS

ATGGAAAATACACAAGAACCAGAGGAAAGCCAGATCCAAGAAACAGAAACCCGCGAGGAGATGCTTTCTAGGCACAGAAAAGAGATCACTCAGTTACAAAACAAGGAAATTGCCCTAAAAAAAGCAGCAGCTAAAGGCAGCAAAGCGGAGCAAAAAGCTAAAAAGAAACAAGTGGAAGAACAAATCTCCCAACTAACAACAGACCTAAAACAAAAACATCTAGCACAACTTGCTACAGTAGGCTATGCTAGTAATAACAC...

Protein

Download Protein FASTA

306 aa · TkA01G418400|TK1151|PROTEIN

MENTQEPEESQIQETETREEMLSRHRKEITQLQNKEIALKKAAAKGSKAEQKAKKKQVEEQISQLTTDLKQKHLAQLATVGYASNNTTIKEDNIDILAKAIAGVSVTHQPEHPKPTKSAKRKEKRAQEEAAREQRIQQEQSNIVSDKMVENEKLEKKLQPLGFTINEIKPDGHCLYRAVEHQLKTKSKSFYTFQELRKMVADYMRKNSADFLPFFLSETETDGDCHERFESYCNEVESTAAWGGQLELGALTHCLKKHIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G418400`
TK1151 ID	TkA01G418400
OH-1004 ID	LXL04_002828
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G418400

Location Chr01:104479393-104481458 (+)

Description Similar to OTU5: OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62940`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	Distinct phylogenetic relationships and biochemical properties of Arabidopsis ovarian tumor-related deubiquitinases support their functional differentiation.2014 · DOI: 10.3389/fpls.2014.00084 The Deubiquitinase OTU5 Regulates Root Responses to Phosphate Starvation.2018 · DOI: 10.1104/pp.17.01525

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002828 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0043248 proteasome assembly Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0140374 antiviral innate immune response Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004843 cysteine-type deubiquitinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G62940

dre:393194

hsa:51633

mmu:72201

xtr:496720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · TkA01G418400 · TK1151

Nucleus0.430

Rank 2 · TkA01G418400 · TK1151

Mitochondrion0.095

Rank 3 · TkA01G418400 · TK1151

Cell membrane0.066

Rank 4 · TkA01G418400 · TK1151

Endoplasmic reticulum0.057

Rank 5 · TkA01G418400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04912Dynamitin7-161 aa

PF24035DUF734424-82 aa

PF02338OTU48-76 aa

PF10275Peptidase_C6550-50 aa

PF24035DUF7344119-119 aa

PF10275Peptidase_C65129-261 aa

PF02338OTU169-300 aa

PF24035DUF7344181-202 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G418400	`PF04912`	Dynamitin	7	161	0.11	12.5
TkA01G418400	`PF24035`	DUF7344	24	82	0.045	14.8
TkA01G418400	`PF02338`	OTU	48	76	4.7e-33	115.1
TkA01G418400	`PF10275`	Peptidase_C65	50	50	1.6e-05	25.3
TkA01G418400	`PF24035`	DUF7344	119	119	0.045	14.8
TkA01G418400	`PF10275`	Peptidase_C65	129	261	1.6e-05	25.3
TkA01G418400	`PF02338`	OTU	169	300	4.7e-33	115.1
TkA01G418400	`PF24035`	DUF7344	181	202	0.045	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYC7`	Arabidopsis thaliana	sp\|Q9LYC7\|OTU5_ARATH OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 5	66.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card