TkA01G416050 | RubberDandelionOmics

Gene overview

TkA01G416050

Reference: TK1151 Chr: Chr01 Coordinates: 103811856-103815900 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2390 bp · TkA01G416050|TK1151|cDNA

CCTGATTCTCTTCTTTGCTTTTTCTTTTTCTTTTTCTTTTTCTCTTTCTGTACAAATACTCTTTGCAATGGCAAATGTTGTGACTTACCCAAATTTGCAGACAGAAATGCCCCACCATTCCAATTAAACTCAGAAGCTTTACTCATATATCCACATTTATTTCACGTTATTCCCCCCCGAAATTTCTTCCAAAATTAATGTTCTTCACTTGCATTCAATGATGATCATGCTTCAAAGCCTCAGATTTTGCTTCCTCTGTT...

CDS

Download CDS FASTA

1914 bp · TkA01G416050|TK1151|CDS

ATGATGATCATGCTTCAAAGCCTCAGATTTTGCTTCCTCTGTTTGTTGCTTTTTGCTCCTCTTTCTCTCTCTTATGAAGCTCGTAATCCCGAAGTTGTAGCTTTAATTTTGATTAGAAATGGTCTGAACGATCCCCATGGAGCTTTTAACAATTGGGATGAAGACTCCGTGGACCCTTGTAGCTGGGCTATGATAACTTGTTCCCCTGATAATCTCGTCACCGGCATTGGAGCTCCAAGCCAAGGTTTATCAGGAACATT...

Protein

Download Protein FASTA

637 aa · TkA01G416050|TK1151|PROTEIN

MMIMLQSLRFCFLCLLLFAPLSLSYEARNPEVVALILIRNGLNDPHGAFNNWDEDSVDPCSWAMITCSPDNLVTGIGAPSQGLSGTLQGVIANLTNLREVLLQNNNISGQIPAGIGRLPKLQTVDLSNNKLTGHVPESLSLLNGLQYLRLNNNSLSGSIPLSLASVPHLALIDLSYNNLSGPVPKFSARTFNIVGNPLICGSHANEGCYGSTLPEPLSFEINSSSGKNKSKRVAIALGISLSCLALLILSLGVLLWKRSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G416050`
TK1151 ID	TkA01G416050
OH-1004 ID	LXL04_002862
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G416050

Location Chr01:103811856-103815900 (-)

Description Similar to At2g23950: Probable LRR receptor-like serine/threonine-protein kinase At2g23950

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g30520`	May act as a receptor kinase regulating meristem homeostasis and protophloem differentiation.	CLERK is a novel receptor kinase required for sensing of root-active CLE peptides in Arabidopsis .2018 · DOI: 10.1242/dev.162354
`At2g23950`	May act as a receptor kinase regulating meristem homeostasis and protophloem differentiation.	CLERK is a novel receptor kinase required for sensing of root-active CLE peptides in Arabidopsis .2018 · DOI: 10.1242/dev.162354 A CLE-BAM-CIK signalling module controls root protophloem differentiation in Arabidopsis.2022 · DOI: 10.1111/nph.17791
`At5g16000`	May act as a receptor kinase regulating meristem homeostasis and protophloem differentiation.	Regulated nuclear trafficking of rpL10A mediated by NIK1 represents a defense strategy of plant cells against virus.2008 · DOI: 10.1371/journal.ppat.1000247 NIK1-mediated translation suppression functions as a plant antiviral immunity mechanism.2015 · DOI: 10.1038/nature14171 CLERK is a novel receptor kinase required for sensing of root-active CLE peptides in Arabidopsis .2018 · DOI: 10.1242/dev.162354
`At3g25560`	Receptor kinase acting, redundantly with other CIKs (e.g. CIK1, CIK2, CIK3, CIK5 and CIK6), as a coreceptor of CLV1, CLV2/CRN and RPK2, and required for CLAVATA-family peptides (e.g. CLV3, CLE25, CLE26 and CLE45) signaling through phosphorylation; this signaling regulates protophloem differentiation and the maintenance of shoot apical meristem (SAM) and root apical meristem (RAM) homeostasis, and acts down-stream of BRX and OPS.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0274500`	LRR receptor kinase that may be involved in defense response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002862 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0007639 homeostasis of number of meristem cells Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010088 phloem development Biological Process

GO:0010150 leaf senescence Biological Process

GO:0034504 protein localization to nucleus Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0040015 negative regulation of multicellular organism growth Biological Process

GO:0048638 regulation of developmental growth Biological Process

GO:0048653 anther development Biological Process

GO:0051607 defense response to virus Biological Process

KEGG gene cross-reference

ath:AT2G23950

ath:AT3G25560

ath:AT4G30520

ath:AT5G16000

dosa:Os06g0274500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.881

Rank 1 · TkA01G416050 · TK1151

Endoplasmic reticulum0.076

Rank 2 · TkA01G416050 · TK1151

Cytoplasm0.074

Rank 3 · TkA01G416050 · TK1151

Nucleus0.050

Rank 4 · TkA01G416050 · TK1151

Lysosome / Vacuole0.022

Rank 5 · TkA01G416050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_229-68 aa

PF12799LRR_467-80 aa

PF23598LRR_1491-155 aa

PF24141LRR_ComC91-138 aa

PF13855LRR_895-155 aa

PF12799LRR_495-132 aa

PF00560LRR_196-118 aa

PF23211LRR_LRWD1112-170 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G416050	`PF08263`	LRRNT_2	29	68	2.1e-12	47.8
TkA01G416050	`PF12799`	LRR_4	67	80	2.2e-11	44.3
TkA01G416050	`PF23598`	LRR_14	91	155	5.5e-07	29.4
TkA01G416050	`PF24141`	LRR_ComC	91	138	0.032	14.6
TkA01G416050	`PF13855`	LRR_8	95	155	3e-13	50.0
TkA01G416050	`PF12799`	LRR_4	95	132	2.2e-11	44.3
TkA01G416050	`PF00560`	LRR_1	96	118	5.1e-12	44.2
TkA01G416050	`PF23211`	LRR_LRWD1	112	170	0.0069	16.8
TkA01G416050	`PF13855`	LRR_8	119	179	3e-13	50.0
TkA01G416050	`PF00560`	LRR_1	120	140	5.1e-12	44.2
TkA01G416050	`PF00560`	LRR_1	145	164	5.1e-12	44.2
TkA01G416050	`PF12799`	LRR_4	145	181	2.2e-11	44.3
TkA01G416050	`PF24141`	LRR_ComC	146	162	0.032	14.6
TkA01G416050	`PF13855`	LRR_8	164	180	3e-13	50.0
TkA01G416050	`PF00560`	LRR_1	169	185	5.1e-12	44.2
TkA01G416050	`PF00560`	LRR_1	189	198	5.1e-12	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYT3`	Arabidopsis thaliana	sp\|Q8VYT3\|CIK3_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 3	72.200%	Swiss-Prot	High
`Q0WVM4`	Arabidopsis thaliana	sp\|Q0WVM4\|CIK2_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 2	71.100%	Swiss-Prot	High
`Q9LFS4`	Arabidopsis thaliana	sp\|Q9LFS4\|CIK5_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 5	64.200%	Swiss-Prot	High
`Q8RY65`	Arabidopsis thaliana	sp\|Q8RY65\|CIK6_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 6	65.100%	Swiss-Prot	High
`Q9FP13`	Oryza sativa subsp. japonica	sp\|Q9FP13\|SERL2_ORYSJ LRR receptor kinase SERL2	69.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card