RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G413330
Reference: TK1151 Chr: Chr01 Coordinates: 103168074-103172403 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3986 bp · TkA01G413330|TK1151|cDNA

AATTCCTTCTTTCTCTCTCTGTCTTGAATACAAACAGACTGCCGTCATCATCATCGTCGTTTTTCCCTACACTAAAACAGAAAAACTCAAATTTACCATCTTTCTCTAACTATAACCTTCCCCACTTATTAATAAATAATTTCTAAAAAGGTTTTTTTGTTTTTATTTTCAGTTTTTACTCATACTTATACATACATACATACAGATACACATGGAGAGAGAAAAAGAGGGTTTCTTTATCATCATCTTCCTGAGAGTCC...

CDS

Download CDS FASTA

3126 bp · TkA01G413330|TK1151|CDS

ATGAGGGCAGGATTGAGTACTATCCAGCAAACCCTAACGCCGGAGGCGGCCACCGTCTTGAATCACTCAATAGCAGAAGCTGGTCGTCGGAACCACGGTCAAACGACGCCGCTTCATGTGGCTTCCACGCTTCTTGCGTCACCGACGGGATTTCTCCGGCAAGCTTGCATCCGGTCACATCCCAATTCGTCTCACCCTCTCCAGTGCCGAGCTCTTGAACTTTGCTTCAGCGTGGCGCTCGAACGGCTCCCCACCGCCAC...

Protein

Download Protein FASTA

1041 aa · TkA01G413330|TK1151|PROTEIN

MRAGLSTIQQTLTPEAATVLNHSIAEAGRRNHGQTTPLHVASTLLASPTGFLRQACIRSHPNSSHPLQCRALELCFSVALERLPTATSSPAVTEPPISNALMAALKRAQAHQRRGCPEQQQQPLLAVKVELEQLIISILDDPSVSRVMREASFSSPAVKATIEQSISNNVSGGSNLSPSNLGIGFRPSPSTATTPVSIPVNRNLYLNPRLQQGNLHKNAESTLSTSSSPRNLYLNPRLQQVNQQKNDETAVASSSPRNLY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G413330
TK1151 IDTkA01G413330
OH-1004 IDLXL04_002891
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 99.808 / OH-1004 85.655
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G413330
LocationChr01:103168074-103172403 (+)
DescriptionSimilar to SMAX1: Protein SUPPRESSOR OF MAX2 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g57710 Probable component of a transcriptional corepressor complex that acts downstream of MAX2 to negatively regulate karrikins/strigolactone responses.
SUPPRESSOR OF MORE AXILLARY GROWTH2 1 controls seed germination and seedling development in Arabidopsis.2013 · DOI: 10.1104/pp.113.221259
SMAX1-LIKE/D53 Family Members Enable Distinct MAX2-Dependent Responses to Strigolactones and Karrikins in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00562
Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2
At4g30350 Probable component of a transcriptional corepressor complex that acts specifically in the karrikin pathway.
Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2
At5g57130 May function in a transcriptional corepressor complex. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os08g0250900 May act downstream of MAX2 to negatively regulate karrikins/strigolactone responses. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_002891 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0007623 circadian rhythm Biological Process
GO:0009845 seed germination Biological Process
GO:0080167 response to karrikin Biological Process
GO:0090351 seedling development Biological Process
GO:1902347 response to strigolactone Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
GO:0044183 protein folding chaperone Molecular Function
KEGG gene cross-reference
ath:AT4G30350
ath:AT5G57710
dosa:Os08g0250900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.894
Rank 1 · TkA01G413330 · TK1151
Cytoplasm0.126
Rank 2 · TkA01G413330 · TK1151
Cell membrane0.050
Rank 3 · TkA01G413330 · TK1151
Endoplasmic reticulum0.037
Rank 4 · TkA01G413330 · TK1151
Plastid0.029
Rank 5 · TkA01G413330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861Clp_N12-113 aa
PF02861Clp_N129-171 aa
PF02861Clp_N228-244 aa
PF23569NBD_SMAX1279-454 aa
PF00004AAA342-425 aa
PF24273TRASH_HVO_1752_C499-525 aa
PF09538FYDLN_acid503-537 aa
PF02861Clp_N514-536 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G413330PF02861Clp_N121138.3e-0833.2
TkA01G413330PF02861Clp_N1291718.3e-0833.2
TkA01G413330PF02861Clp_N2282448.3e-0833.2
TkA01G413330PF23569NBD_SMAX12794549.9e-33114.4
TkA01G413330PF00004AAA3424250.2712.4
TkA01G413330PF24273TRASH_HVO_1752_C4995250.2312.3
TkA01G413330PF09538FYDLN_acid5035377.28.1
TkA01G413330PF02861Clp_N5145368.3e-0833.2
TkA01G413330PF00004AAA7127840.2712.4
TkA01G413330PF07724AAA_27138243.3e-0937.7
TkA01G413330PF23569NBD_SMAX17588019.9e-33114.4
TkA01G413330PF09538FYDLN_acid8709037.28.1
TkA01G413330PF26587AAA_lid_SMAX194010224e-2278.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FHH2Arabidopsis thalianasp|Q9FHH2|SMAX1_ARATH Protein SUPPRESSOR OF MAX2 148.900%Swiss-ProtMedium
Q9M0C5Arabidopsis thalianasp|Q9M0C5|SMXL2_ARATH Protein SMAX1-LIKE 244.500%Swiss-ProtMedium
Q9LU73Arabidopsis thalianasp|Q9LU73|SMXL5_ARATH Protein SMAX1-LIKE 531.400%Swiss-ProtMedium
Q6Z517Oryza sativa subsp. japonicasp|Q6Z517|SMAX1_ORYSJ Protein SMAX1-like37.800%Swiss-ProtMedium

JBrowse

View in Genome Browser