TkA01G412020 | RubberDandelionOmics

Gene overview

TkA01G412020

Reference: TK1151 Chr: Chr01 Coordinates: 102765939-102767505 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1049 bp · TkA01G412020|TK1151|cDNA

TAACTTGCACATGTTAGCGTCGCCCGCTACAAAACCGGTATTCATCATTTTCATCTTTCCATATACACACAGCCCTCACTCGATCACTCCGGTTTCACCTTTTTCTCTACGTCTTTCTCAGACCTTTCGCAACCCCAGTGACTGAGAAACAGAGCGAGCAATTAGTTTCAGAAGAAGAAAAATACACCATGCCTCGCGAAATCATCAATTTGCAAGTAGGACAATGTGGAAATCAGATCGGGATGGAGTTCTGGAAACAA...

CDS

Download CDS FASTA

861 bp · TkA01G412020|TK1151|CDS

ATGCCTCGCGAAATCATCAATTTGCAAGTAGGACAATGTGGAAATCAGATCGGGATGGAGTTCTGGAAACAACTATGCCTTGAACACGGGATATCTAAAGACGGCATTCTCGAGGAATACGCCACTCAGGGAGGTGCAGGCGACAGAAAAGACGTATTCTTCTATCAAGCTGATGATCAACATTACATACCACGAGCTTTGCTTGTGGATCTAGAGCCTAGAGTGATCAACGGAATCCAAACAGGTGAATACAGAGATCT...

Protein

Download Protein FASTA

287 aa · TkA01G412020|TK1151|PROTEIN

MPREIINLQVGQCGNQIGMEFWKQLCLEHGISKDGILEEYATQGGAGDRKDVFFYQADDQHYIPRALLVDLEPRVINGIQTGEYRDLYNHENIFISQEGAGAGNNWASGYDQGKHFEEDLMDMIDREADGSDSLEGFVLCHSIAGGTGSGMGSYILETLNDHYSKKLIQTYSVFPNQNETSDVVVQPYNSLLTLKRLTLNADCVVVIDNTALNRIAVERLHIQNPTVSETNSLVSTVMAASTTTLRYPGYMNNDLVGLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G412020`
TK1151 ID	TkA01G412020
OH-1004 ID	LXL04_007542
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 54.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G412020

Location Chr01:102765939-102767505 (-)

Description Similar to TUBG1: Tubulin gamma-1 chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05620`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343
`At3g61650`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0156600`	Tubulin is the major constituent of microtubules.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007542 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0000212 meiotic spindle organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007020 microtubule nucleation Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0009624 response to nematode Biological Process

GO:0010103 stomatal complex morphogenesis Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0048366 leaf development Biological Process

GO:0048768 root hair cell tip growth Biological Process

KEGG gene cross-reference

ath:AT3G61650

ath:AT5G05620

dosa:Os05g0156600

zma:542436

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.670

Rank 1 · TkA01G412020 · TK1151

Mitochondrion0.192

Rank 2 · TkA01G412020 · TK1151

Nucleus0.163

Rank 3 · TkA01G412020 · TK1151

Cell membrane0.047

Rank 4 · TkA01G412020 · TK1151

Endoplasmic reticulum0.029

Rank 5 · TkA01G412020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10644Misat_Tub_SegII3-86 aa

PF00091Tubulin4-216 aa

PF14881Tubulin_3108-209 aa

PF13809Tubulin_2132-176 aa

PF15497SNAPC5210-241 aa

PF03953Tubulin_C223-244 aa

PF03953Tubulin_C266-284 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G412020	`PF10644`	Misat_Tub_SegII	3	86	0.00096	20.2
TkA01G412020	`PF00091`	Tubulin	4	216	3.7e-62	210.7
TkA01G412020	`PF14881`	Tubulin_3	108	209	0.043	14.2
TkA01G412020	`PF13809`	Tubulin_2	132	176	0.0053	16.7
TkA01G412020	`PF15497`	SNAPC5	210	241	0.14	13.4
TkA01G412020	`PF03953`	Tubulin_C	223	244	0.0062	17.4
TkA01G412020	`PF03953`	Tubulin_C	266	284	0.0062	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P38558`	Arabidopsis thaliana	sp\|P38558\|TBG2_ARATH Tubulin gamma-2 chain	88.500%	Swiss-Prot	High
`P38557`	Arabidopsis thaliana	sp\|P38557\|TBG1_ARATH Tubulin gamma-1 chain	87.500%	Swiss-Prot	High
`O49068`	Oryza sativa subsp. japonica	sp\|O49068\|TBG2_ORYSJ Tubulin gamma-2 chain	86.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card